FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629802_at:

>probe:Drosophila_2:1629802_at:388:565; Interrogation_Position=117; Antisense; GGAATTCTCAGAATCCGTTCCCATT
>probe:Drosophila_2:1629802_at:100:683; Interrogation_Position=148; Antisense; TATGAGCTTTTGACAGCCCGCGAGG
>probe:Drosophila_2:1629802_at:495:425; Interrogation_Position=209; Antisense; GAGAGATTCGTCAAAGTCTGCAAAT
>probe:Drosophila_2:1629802_at:159:101; Interrogation_Position=250; Antisense; AGAGTAGCTGGCACCAAGCCGCTGG
>probe:Drosophila_2:1629802_at:561:547; Interrogation_Position=324; Antisense; GGAGGCGATTGCCATCATCCGGAAC
>probe:Drosophila_2:1629802_at:539:389; Interrogation_Position=366; Antisense; GAAACAGGACTCACTGACACTCCAG
>probe:Drosophila_2:1629802_at:434:265; Interrogation_Position=394; Antisense; CAGATCAGCTTACCTGCGGTTGCTC
>probe:Drosophila_2:1629802_at:442:203; Interrogation_Position=426; Antisense; AAGCCAGCGATTTCCTTTAATCACA
>probe:Drosophila_2:1629802_at:304:483; Interrogation_Position=482; Antisense; GTAGACCAAAGGATCTTCCGCCAGT
>probe:Drosophila_2:1629802_at:502:385; Interrogation_Position=510; Antisense; GAACAGTCCGGATAACTCAGCCGAT
>probe:Drosophila_2:1629802_at:336:445; Interrogation_Position=532; Antisense; GATGACTCATTTCACACCGCTAAAA
>probe:Drosophila_2:1629802_at:234:359; Interrogation_Position=563; Antisense; GCAACTGCATCTGGCTGAACGGATT
>probe:Drosophila_2:1629802_at:445:415; Interrogation_Position=61; Antisense; GAGCCGCACTTTAATCTGGTCCATG
>probe:Drosophila_2:1629802_at:701:591; Interrogation_Position=77; Antisense; TGGTCCATGGACAGATCGCCTATGA

Paste this into a BLAST search page for me
GGAATTCTCAGAATCCGTTCCCATTTATGAGCTTTTGACAGCCCGCGAGGGAGAGATTCGTCAAAGTCTGCAAATAGAGTAGCTGGCACCAAGCCGCTGGGGAGGCGATTGCCATCATCCGGAACGAAACAGGACTCACTGACACTCCAGCAGATCAGCTTACCTGCGGTTGCTCAAGCCAGCGATTTCCTTTAATCACAGTAGACCAAAGGATCTTCCGCCAGTGAACAGTCCGGATAACTCAGCCGATGATGACTCATTTCACACCGCTAAAAGCAACTGCATCTGGCTGAACGGATTGAGCCGCACTTTAATCTGGTCCATGTGGTCCATGGACAGATCGCCTATGA

Full Affymetrix probeset data:

Annotations for 1629802_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720