Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629804_s_at:

>probe:Drosophila_2:1629804_s_at:193:627; Interrogation_Position=1076; Antisense; TGCCAGTAAATGTCTCCGCCTAAAA
>probe:Drosophila_2:1629804_s_at:449:447; Interrogation_Position=542; Antisense; GATGCGGATACATCCCAGACGAAAA
>probe:Drosophila_2:1629804_s_at:557:131; Interrogation_Position=568; Antisense; ACCGACAACAAGTGCGTGAGACGCT
>probe:Drosophila_2:1629804_s_at:709:423; Interrogation_Position=585; Antisense; GAGACGCTCGGGAACCCACGACGTG
>probe:Drosophila_2:1629804_s_at:537:669; Interrogation_Position=619; Antisense; TACTGCTCCTGCACCAAGGATCTGT
>probe:Drosophila_2:1629804_s_at:380:83; Interrogation_Position=671; Antisense; AGTGGATGATGCTGCCCCTCATTGT
>probe:Drosophila_2:1629804_s_at:575:3; Interrogation_Position=705; Antisense; ATTGGCGCTCCTGCTGAACTCGAGG
>probe:Drosophila_2:1629804_s_at:249:437; Interrogation_Position=726; Antisense; GAGGCACACAATACGATTCCAGAGC
>probe:Drosophila_2:1629804_s_at:368:247; Interrogation_Position=756; Antisense; AATTGGGCTCGAATTAGCGTTTCAT
>probe:Drosophila_2:1629804_s_at:514:325; Interrogation_Position=772; Antisense; GCGTTTCATTGCGTTCAACTGTACT
>probe:Drosophila_2:1629804_s_at:475:229; Interrogation_Position=819; Antisense; AATGGTTTTTCGATTCAGTTCTGCA
>probe:Drosophila_2:1629804_s_at:80:267; Interrogation_Position=834; Antisense; CAGTTCTGCAGTTGATGCTCATTTA
>probe:Drosophila_2:1629804_s_at:351:707; Interrogation_Position=930; Antisense; TTAACTTACCTTATGCGTTCGCATG
>probe:Drosophila_2:1629804_s_at:154:181; Interrogation_Position=985; Antisense; AAAAGGTAACACACACTCTCTTGGG

Paste this into a BLAST search page for me
TGCCAGTAAATGTCTCCGCCTAAAAGATGCGGATACATCCCAGACGAAAAACCGACAACAAGTGCGTGAGACGCTGAGACGCTCGGGAACCCACGACGTGTACTGCTCCTGCACCAAGGATCTGTAGTGGATGATGCTGCCCCTCATTGTATTGGCGCTCCTGCTGAACTCGAGGGAGGCACACAATACGATTCCAGAGCAATTGGGCTCGAATTAGCGTTTCATGCGTTTCATTGCGTTCAACTGTACTAATGGTTTTTCGATTCAGTTCTGCACAGTTCTGCAGTTGATGCTCATTTATTAACTTACCTTATGCGTTCGCATGAAAAGGTAACACACACTCTCTTGGG

Full Affymetrix probeset data:

Annotations for 1629804_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime