Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629805_at:

>probe:Drosophila_2:1629805_at:633:35; Interrogation_Position=2924; Antisense; ATCTTTAGACTAACATTGCCTTACT
>probe:Drosophila_2:1629805_at:449:627; Interrogation_Position=2940; Antisense; TGCCTTACTAAACTGATGCTACCGC
>probe:Drosophila_2:1629805_at:511:443; Interrogation_Position=2954; Antisense; GATGCTACCGCATTTACAAATTACT
>probe:Drosophila_2:1629805_at:296:709; Interrogation_Position=2967; Antisense; TTACAAATTACTACGGCAGGATTCG
>probe:Drosophila_2:1629805_at:6:143; Interrogation_Position=2979; Antisense; ACGGCAGGATTCGTATTGCTTCAAA
>probe:Drosophila_2:1629805_at:443:663; Interrogation_Position=3059; Antisense; TAAAGACAATCATGCACGGATGGAT
>probe:Drosophila_2:1629805_at:165:617; Interrogation_Position=3071; Antisense; TGCACGGATGGATTACACTATGTAA
>probe:Drosophila_2:1629805_at:500:519; Interrogation_Position=3105; Antisense; GTGGCGATTAACTATCCGTATATTA
>probe:Drosophila_2:1629805_at:725:165; Interrogation_Position=3133; Antisense; AAATGCATTCGGCAATTCAGAAGAA
>probe:Drosophila_2:1629805_at:148:21; Interrogation_Position=3161; Antisense; ATTTGAGCATAAGCACCTGACTATT
>probe:Drosophila_2:1629805_at:438:131; Interrogation_Position=3175; Antisense; ACCTGACTATTGTGTTGGCATGGAT
>probe:Drosophila_2:1629805_at:303:219; Interrogation_Position=3274; Antisense; AAGTCAGTGGAACAGTACAGTAGAT
>probe:Drosophila_2:1629805_at:549:267; Interrogation_Position=3313; Antisense; CAGTGTAACATTTGATTTGGCAGTT
>probe:Drosophila_2:1629805_at:409:189; Interrogation_Position=3340; Antisense; AACATGGTGCAACTGCTCAACTAAT

Paste this into a BLAST search page for me
ATCTTTAGACTAACATTGCCTTACTTGCCTTACTAAACTGATGCTACCGCGATGCTACCGCATTTACAAATTACTTTACAAATTACTACGGCAGGATTCGACGGCAGGATTCGTATTGCTTCAAATAAAGACAATCATGCACGGATGGATTGCACGGATGGATTACACTATGTAAGTGGCGATTAACTATCCGTATATTAAAATGCATTCGGCAATTCAGAAGAAATTTGAGCATAAGCACCTGACTATTACCTGACTATTGTGTTGGCATGGATAAGTCAGTGGAACAGTACAGTAGATCAGTGTAACATTTGATTTGGCAGTTAACATGGTGCAACTGCTCAACTAAT

Full Affymetrix probeset data:

Annotations for 1629805_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime