FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629808_at:

>probe:Drosophila_2:1629808_at:652:307; Interrogation_Position=106; Antisense; CCACCAGCGGTGGATACGATGCGGT
>probe:Drosophila_2:1629808_at:30:623; Interrogation_Position=125; Antisense; TGCGGTGGCCACTGGACCAGGATCT
>probe:Drosophila_2:1629808_at:579:519; Interrogation_Position=13; Antisense; GTGGCAAGAATTCCCGCGGCATTCG
>probe:Drosophila_2:1629808_at:680:141; Interrogation_Position=135; Antisense; ACTGGACCAGGATCTGGCGGCAACG
>probe:Drosophila_2:1629808_at:344:197; Interrogation_Position=156; Antisense; AACGGCGGCAGCAACTGCATGGCCT
>probe:Drosophila_2:1629808_at:716:193; Interrogation_Position=168; Antisense; AACTGCATGGCCTCAAAGACGCTGG
>probe:Drosophila_2:1629808_at:416:581; Interrogation_Position=175; Antisense; TGGCCTCAAAGACGCTGGGCAACCA
>probe:Drosophila_2:1629808_at:305:593; Interrogation_Position=190; Antisense; TGGGCAACCAGAGGAAGTTCCAGCC
>probe:Drosophila_2:1629808_at:154:95; Interrogation_Position=199; Antisense; AGAGGAAGTTCCAGCCCGGCGGCCA
>probe:Drosophila_2:1629808_at:253:533; Interrogation_Position=226; Antisense; GGGTGGCGACCATCAGCCAGAACTA
>probe:Drosophila_2:1629808_at:649:413; Interrogation_Position=233; Antisense; GACCATCAGCCAGAACTACAACGAG
>probe:Drosophila_2:1629808_at:219:199; Interrogation_Position=252; Antisense; AACGAGAAGACCATGCTGCTGAGCA
>probe:Drosophila_2:1629808_at:4:571; Interrogation_Position=30; Antisense; GGCATTCGCGTCTCCAGCTACGATC
>probe:Drosophila_2:1629808_at:542:449; Interrogation_Position=51; Antisense; GATCCCGACGATCCCAGCTCGGGAG

Paste this into a BLAST search page for me
CCACCAGCGGTGGATACGATGCGGTTGCGGTGGCCACTGGACCAGGATCTGTGGCAAGAATTCCCGCGGCATTCGACTGGACCAGGATCTGGCGGCAACGAACGGCGGCAGCAACTGCATGGCCTAACTGCATGGCCTCAAAGACGCTGGTGGCCTCAAAGACGCTGGGCAACCATGGGCAACCAGAGGAAGTTCCAGCCAGAGGAAGTTCCAGCCCGGCGGCCAGGGTGGCGACCATCAGCCAGAACTAGACCATCAGCCAGAACTACAACGAGAACGAGAAGACCATGCTGCTGAGCAGGCATTCGCGTCTCCAGCTACGATCGATCCCGACGATCCCAGCTCGGGAG

Full Affymetrix probeset data:

Annotations for 1629808_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720