Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629809_at:

>probe:Drosophila_2:1629809_at:320:269; Interrogation_Position=1036; Antisense; CAGGCACATGGGATTCTTCAATAAT
>probe:Drosophila_2:1629809_at:78:333; Interrogation_Position=1067; Antisense; GCTGGACTCTTTGTTAAGCCTTTGT
>probe:Drosophila_2:1629809_at:393:725; Interrogation_Position=1093; Antisense; TTGGCCCTTTGTTAAGACTCCGAGA
>probe:Drosophila_2:1629809_at:107:395; Interrogation_Position=1116; Antisense; GAAATGGTGCTCAGACCTCGTTGTA
>probe:Drosophila_2:1629809_at:669:129; Interrogation_Position=1130; Antisense; ACCTCGTTGTATGTTGCTCTGGATC
>probe:Drosophila_2:1629809_at:443:511; Interrogation_Position=1169; Antisense; GTGACAGGACAATACTTCAGCGACT
>probe:Drosophila_2:1629809_at:163:681; Interrogation_Position=1315; Antisense; TATGTTTCTGACAATCCCTCTGTTA
>probe:Drosophila_2:1629809_at:252:45; Interrogation_Position=1328; Antisense; ATCCCTCTGTTACTTCGCATAAATT
>probe:Drosophila_2:1629809_at:334:497; Interrogation_Position=771; Antisense; GTCATTTCCTGCTTACCAATTTACT
>probe:Drosophila_2:1629809_at:247:395; Interrogation_Position=811; Antisense; GAAATCCTCACCCAGTCGGATTGTA
>probe:Drosophila_2:1629809_at:486:683; Interrogation_Position=840; Antisense; TATCCAGTTTGGCACACACTCGAGG
>probe:Drosophila_2:1629809_at:607:93; Interrogation_Position=933; Antisense; AGTTGGCCAATGTACTCTTCACAAG
>probe:Drosophila_2:1629809_at:64:3; Interrogation_Position=973; Antisense; ATTAGAGGGCACCAACGTAACGGCG
>probe:Drosophila_2:1629809_at:378:369; Interrogation_Position=997; Antisense; GAATGCCCTGCATCCAGGTGTGGTG

Paste this into a BLAST search page for me
CAGGCACATGGGATTCTTCAATAATGCTGGACTCTTTGTTAAGCCTTTGTTTGGCCCTTTGTTAAGACTCCGAGAGAAATGGTGCTCAGACCTCGTTGTAACCTCGTTGTATGTTGCTCTGGATCGTGACAGGACAATACTTCAGCGACTTATGTTTCTGACAATCCCTCTGTTAATCCCTCTGTTACTTCGCATAAATTGTCATTTCCTGCTTACCAATTTACTGAAATCCTCACCCAGTCGGATTGTATATCCAGTTTGGCACACACTCGAGGAGTTGGCCAATGTACTCTTCACAAGATTAGAGGGCACCAACGTAACGGCGGAATGCCCTGCATCCAGGTGTGGTG

Full Affymetrix probeset data:

Annotations for 1629809_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime