FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629810_at:

>probe:Drosophila_2:1629810_at:617:417; Interrogation_Position=112; Antisense; GAGCTGCTCATCTTTATTGGCCAGG
>probe:Drosophila_2:1629810_at:19:263; Interrogation_Position=183; Antisense; CAGCTGTGTGGATGCCTGCAAGCAC
>probe:Drosophila_2:1629810_at:681:511; Interrogation_Position=257; Antisense; GTGAGAGGATGCACTTGACCCTGCT
>probe:Drosophila_2:1629810_at:24:651; Interrogation_Position=290; Antisense; TCACGTTGCAGTTCCAGCACGAGTT
>probe:Drosophila_2:1629810_at:251:213; Interrogation_Position=319; Antisense; AAGAGCCATCGCTTGATCCAACTGG
>probe:Drosophila_2:1629810_at:625:195; Interrogation_Position=338; Antisense; AACTGGTGCCGCTGGACATGACGGA
>probe:Drosophila_2:1629810_at:215:337; Interrogation_Position=385; Antisense; GCTCCATCCAATCTGGGCAATGTCA
>probe:Drosophila_2:1629810_at:435:497; Interrogation_Position=406; Antisense; GTCATCAGCCAATTCTTGCTGTGCA
>probe:Drosophila_2:1629810_at:151:31; Interrogation_Position=436; Antisense; ATAAATCCCGATTTCCAGCAGGAGG
>probe:Drosophila_2:1629810_at:322:77; Interrogation_Position=509; Antisense; AGGAGTTGCAGGCTCACATGCCCTT
>probe:Drosophila_2:1629810_at:531:437; Interrogation_Position=52; Antisense; GAGGAGAAGCCAGCGGCCTGTCTCA
>probe:Drosophila_2:1629810_at:707:363; Interrogation_Position=550; Antisense; GAATTCGACCTGGATCCAACACAGA
>probe:Drosophila_2:1629810_at:482:315; Interrogation_Position=67; Antisense; GCCTGTCTCATTACCGAAATCAACT
>probe:Drosophila_2:1629810_at:462:395; Interrogation_Position=82; Antisense; GAAATCAACTGCTACGTGGCCCAGT

Paste this into a BLAST search page for me
GAGCTGCTCATCTTTATTGGCCAGGCAGCTGTGTGGATGCCTGCAAGCACGTGAGAGGATGCACTTGACCCTGCTTCACGTTGCAGTTCCAGCACGAGTTAAGAGCCATCGCTTGATCCAACTGGAACTGGTGCCGCTGGACATGACGGAGCTCCATCCAATCTGGGCAATGTCAGTCATCAGCCAATTCTTGCTGTGCAATAAATCCCGATTTCCAGCAGGAGGAGGAGTTGCAGGCTCACATGCCCTTGAGGAGAAGCCAGCGGCCTGTCTCAGAATTCGACCTGGATCCAACACAGAGCCTGTCTCATTACCGAAATCAACTGAAATCAACTGCTACGTGGCCCAGT

Full Affymetrix probeset data:

Annotations for 1629810_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720