FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629811_at:

>probe:Drosophila_2:1629811_at:104:675; Interrogation_Position=3566; Antisense; TAGTTATTCCTTTTCGGTTGATTCT
>probe:Drosophila_2:1629811_at:88:291; Interrogation_Position=3580; Antisense; CGGTTGATTCTTTCAATTATCTATG
>probe:Drosophila_2:1629811_at:5:163; Interrogation_Position=3627; Antisense; ACAATTTGAGCTCTTCTTATCCACA
>probe:Drosophila_2:1629811_at:372:419; Interrogation_Position=3634; Antisense; GAGCTCTTCTTATCCACAACAGAAC
>probe:Drosophila_2:1629811_at:483:155; Interrogation_Position=3652; Antisense; ACAGAACCTTAAATAGCCTATATCA
>probe:Drosophila_2:1629811_at:492:205; Interrogation_Position=3688; Antisense; AAGCGAATAGCTACTTATAACAATT
>probe:Drosophila_2:1629811_at:335:717; Interrogation_Position=3740; Antisense; TTCCGACCGAAAACACGAATAAGAG
>probe:Drosophila_2:1629811_at:252:389; Interrogation_Position=3915; Antisense; GAAACTTCTCGAACATAACTAATGT
>probe:Drosophila_2:1629811_at:496:59; Interrogation_Position=3936; Antisense; ATGTCCACAAATCCAAATGACTTAG
>probe:Drosophila_2:1629811_at:24:149; Interrogation_Position=3955; Antisense; ACTTAGACTGAAGCGTGAGTATGCA
>probe:Drosophila_2:1629811_at:346:183; Interrogation_Position=3980; Antisense; AAAAGTGTTATGAGATCTGCCCAAA
>probe:Drosophila_2:1629811_at:406:425; Interrogation_Position=3991; Antisense; GAGATCTGCCCAAAAACCAGAAATT
>probe:Drosophila_2:1629811_at:338:523; Interrogation_Position=4036; Antisense; GGGCTCTTGTCATCATGAGTTCCAC
>probe:Drosophila_2:1629811_at:566:57; Interrogation_Position=4050; Antisense; ATGAGTTCCACTTTACACTTACAAA

Paste this into a BLAST search page for me
TAGTTATTCCTTTTCGGTTGATTCTCGGTTGATTCTTTCAATTATCTATGACAATTTGAGCTCTTCTTATCCACAGAGCTCTTCTTATCCACAACAGAACACAGAACCTTAAATAGCCTATATCAAAGCGAATAGCTACTTATAACAATTTTCCGACCGAAAACACGAATAAGAGGAAACTTCTCGAACATAACTAATGTATGTCCACAAATCCAAATGACTTAGACTTAGACTGAAGCGTGAGTATGCAAAAAGTGTTATGAGATCTGCCCAAAGAGATCTGCCCAAAAACCAGAAATTGGGCTCTTGTCATCATGAGTTCCACATGAGTTCCACTTTACACTTACAAA

Full Affymetrix probeset data:

Annotations for 1629811_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720