FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629812_at:

>probe:Drosophila_2:1629812_at:606:667; Interrogation_Position=101; Antisense; TACTCAATGAGGTCACATCGCTGCC
>probe:Drosophila_2:1629812_at:199:97; Interrogation_Position=161; Antisense; AGATATCGCCCATGAGGAGGCCACA
>probe:Drosophila_2:1629812_at:7:581; Interrogation_Position=179; Antisense; GGCCACACAGGAGGGATTATTTCGT
>probe:Drosophila_2:1629812_at:668:13; Interrogation_Position=194; Antisense; ATTATTTCGTGAAGAGGCGCCCGGT
>probe:Drosophila_2:1629812_at:231:321; Interrogation_Position=212; Antisense; GCCCGGTCATCAGCTCTAGGATGAT
>probe:Drosophila_2:1629812_at:150:59; Interrogation_Position=232; Antisense; ATGATGATGTCCAGAAGTCCCTTCC
>probe:Drosophila_2:1629812_at:293:663; Interrogation_Position=24; Antisense; TAAACTTGCCCTTCTTATTCTGGTC
>probe:Drosophila_2:1629812_at:672:135; Interrogation_Position=261; Antisense; ACGTCTTTACAACGATCCAGTGCCG
>probe:Drosophila_2:1629812_at:331:723; Interrogation_Position=290; Antisense; TTGCACCAGGTGGAGCCAACTACTT
>probe:Drosophila_2:1629812_at:74:193; Interrogation_Position=307; Antisense; AACTACTTTGGCAATGACGTCCTGC
>probe:Drosophila_2:1629812_at:292:651; Interrogation_Position=337; Antisense; TCAACCTACGAGATCCTGGAACCAG
>probe:Drosophila_2:1629812_at:82:689; Interrogation_Position=39; Antisense; TATTCTGGTCATTGCCTGTTTGGTC
>probe:Drosophila_2:1629812_at:651:593; Interrogation_Position=55; Antisense; TGTTTGGTCCTTATCGCATGGGCAC
>probe:Drosophila_2:1629812_at:34:413; Interrogation_Position=80; Antisense; GACCCAGGTCGAGATCTTCAATACT

Paste this into a BLAST search page for me
TACTCAATGAGGTCACATCGCTGCCAGATATCGCCCATGAGGAGGCCACAGGCCACACAGGAGGGATTATTTCGTATTATTTCGTGAAGAGGCGCCCGGTGCCCGGTCATCAGCTCTAGGATGATATGATGATGTCCAGAAGTCCCTTCCTAAACTTGCCCTTCTTATTCTGGTCACGTCTTTACAACGATCCAGTGCCGTTGCACCAGGTGGAGCCAACTACTTAACTACTTTGGCAATGACGTCCTGCTCAACCTACGAGATCCTGGAACCAGTATTCTGGTCATTGCCTGTTTGGTCTGTTTGGTCCTTATCGCATGGGCACGACCCAGGTCGAGATCTTCAATACT

Full Affymetrix probeset data:

Annotations for 1629812_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720