FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629813_at:

>probe:Drosophila_2:1629813_at:74:455; Interrogation_Position=1022; Antisense; GATCAGAACTAGCATCCTACATTCA
>probe:Drosophila_2:1629813_at:577:511; Interrogation_Position=1053; Antisense; GTGTTTTTTGCACCTTGAAGCACCC
>probe:Drosophila_2:1629813_at:271:531; Interrogation_Position=1088; Antisense; TGGCTGGTTGGGATACTCCGTTTCC
>probe:Drosophila_2:1629813_at:701:497; Interrogation_Position=1117; Antisense; GTCTTCGAGCCTTTTTATATGCCCG
>probe:Drosophila_2:1629813_at:705:687; Interrogation_Position=1132; Antisense; TATATGCCCGATAAACACCGATGTT
>probe:Drosophila_2:1629813_at:181:69; Interrogation_Position=675; Antisense; AGGCCTTATCCTTGCATGTATTCGT
>probe:Drosophila_2:1629813_at:568:59; Interrogation_Position=690; Antisense; ATGTATTCGTGATCCAAACCCTTGC
>probe:Drosophila_2:1629813_at:712:197; Interrogation_Position=706; Antisense; AACCCTTGCATTGTTTTTGAGCCAA
>probe:Drosophila_2:1629813_at:361:177; Interrogation_Position=731; Antisense; AAACTTTATATCGAGCTGCCGTTGA
>probe:Drosophila_2:1629813_at:187:93; Interrogation_Position=759; Antisense; AGTTCCCGCGGAGTACTATACATCA
>probe:Drosophila_2:1629813_at:274:171; Interrogation_Position=817; Antisense; AAAGACGTCACACTTATTGGTTGGG
>probe:Drosophila_2:1629813_at:477:15; Interrogation_Position=928; Antisense; ATTTTGCCGTGGGACGCTATTACCA
>probe:Drosophila_2:1629813_at:689:13; Interrogation_Position=946; Antisense; ATTACCATTTGCACCTCTGCTAAAA
>probe:Drosophila_2:1629813_at:146:7; Interrogation_Position=988; Antisense; ATTGCGCATGAAGCTCCATTAACAC

Paste this into a BLAST search page for me
GATCAGAACTAGCATCCTACATTCAGTGTTTTTTGCACCTTGAAGCACCCTGGCTGGTTGGGATACTCCGTTTCCGTCTTCGAGCCTTTTTATATGCCCGTATATGCCCGATAAACACCGATGTTAGGCCTTATCCTTGCATGTATTCGTATGTATTCGTGATCCAAACCCTTGCAACCCTTGCATTGTTTTTGAGCCAAAAACTTTATATCGAGCTGCCGTTGAAGTTCCCGCGGAGTACTATACATCAAAAGACGTCACACTTATTGGTTGGGATTTTGCCGTGGGACGCTATTACCAATTACCATTTGCACCTCTGCTAAAAATTGCGCATGAAGCTCCATTAACAC

Full Affymetrix probeset data:

Annotations for 1629813_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720