Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629814_at:

>probe:Drosophila_2:1629814_at:730:703; Interrogation_Position=1872; Antisense; TTAGATCAATGGTCAACCTTAGCAG
>probe:Drosophila_2:1629814_at:223:227; Interrogation_Position=1879; Antisense; AATGGTCAACCTTAGCAGTACTCAC
>probe:Drosophila_2:1629814_at:312:653; Interrogation_Position=1884; Antisense; TCAACCTTAGCAGTACTCACCTATA
>probe:Drosophila_2:1629814_at:425:305; Interrogation_Position=1888; Antisense; CCTTAGCAGTACTCACCTATAGTGA
>probe:Drosophila_2:1629814_at:182:647; Interrogation_Position=1900; Antisense; TCACCTATAGTGAAAGTCTTATGAC
>probe:Drosophila_2:1629814_at:453:391; Interrogation_Position=1911; Antisense; GAAAGTCTTATGACTGAGACATCGA
>probe:Drosophila_2:1629814_at:83:679; Interrogation_Position=1919; Antisense; TATGACTGAGACATCGAGAATGGAT
>probe:Drosophila_2:1629814_at:398:421; Interrogation_Position=1934; Antisense; GAGAATGGATGCAGTCACCCTTTTT
>probe:Drosophila_2:1629814_at:395:229; Interrogation_Position=1937; Antisense; AATGGATGCAGTCACCCTTTTTTAT
>probe:Drosophila_2:1629814_at:32:447; Interrogation_Position=1941; Antisense; GATGCAGTCACCCTTTTTTATTTTA
>probe:Drosophila_2:1629814_at:356:611; Interrogation_Position=1943; Antisense; TGCAGTCACCCTTTTTTATTTTATT
>probe:Drosophila_2:1629814_at:298:701; Interrogation_Position=1975; Antisense; TTTTTTCATTATTCACTACAGTTGA
>probe:Drosophila_2:1629814_at:595:679; Interrogation_Position=1984; Antisense; TATTCACTACAGTTGAAGAACTAAT
>probe:Drosophila_2:1629814_at:621:383; Interrogation_Position=2001; Antisense; GAACTAATAATAATTGGATCTCTAA

Paste this into a BLAST search page for me
TTAGATCAATGGTCAACCTTAGCAGAATGGTCAACCTTAGCAGTACTCACTCAACCTTAGCAGTACTCACCTATACCTTAGCAGTACTCACCTATAGTGATCACCTATAGTGAAAGTCTTATGACGAAAGTCTTATGACTGAGACATCGATATGACTGAGACATCGAGAATGGATGAGAATGGATGCAGTCACCCTTTTTAATGGATGCAGTCACCCTTTTTTATGATGCAGTCACCCTTTTTTATTTTATGCAGTCACCCTTTTTTATTTTATTTTTTTTCATTATTCACTACAGTTGATATTCACTACAGTTGAAGAACTAATGAACTAATAATAATTGGATCTCTAA

Full Affymetrix probeset data:

Annotations for 1629814_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime