FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629815_at:

>probe:Drosophila_2:1629815_at:611:421; Interrogation_Position=121; Antisense; GAGAATCCCATGGATACGTGCGCCT
>probe:Drosophila_2:1629815_at:588:611; Interrogation_Position=170; Antisense; TGACAAATCATTCGTCGTCTTTCCC
>probe:Drosophila_2:1629815_at:541:481; Interrogation_Position=186; Antisense; GTCTTTCCCGAATGCCGACTAAAAG
>probe:Drosophila_2:1629815_at:114:429; Interrogation_Position=284; Antisense; GAGATTCATCACTTACCGGAAGCTA
>probe:Drosophila_2:1629815_at:625:289; Interrogation_Position=311; Antisense; CGGATACCATCCGTTTCTATTTAAT
>probe:Drosophila_2:1629815_at:81:387; Interrogation_Position=345; Antisense; GAACACTGTCGCGTCCTAAGGTATC
>probe:Drosophila_2:1629815_at:632:539; Interrogation_Position=364; Antisense; GGTATCCAAATCGTCTCAGAGTCTT
>probe:Drosophila_2:1629815_at:391:429; Interrogation_Position=382; Antisense; GAGTCTTCTACTATTTCTACACCGC
>probe:Drosophila_2:1629815_at:558:315; Interrogation_Position=405; Antisense; GCCTTTATGCCCTTTTCCAATATTA
>probe:Drosophila_2:1629815_at:95:563; Interrogation_Position=466; Antisense; GGAACTGCACCTTGGATGATCGTAT
>probe:Drosophila_2:1629815_at:70:451; Interrogation_Position=483; Antisense; GATCGTATGTTTGCCAAGGTCCCAT
>probe:Drosophila_2:1629815_at:164:533; Interrogation_Position=549; Antisense; GGTGTCGTGAACTGGATTTCCATCA
>probe:Drosophila_2:1629815_at:395:19; Interrogation_Position=74; Antisense; ATTTGCCCTGATGAAGTACCTCTTG
>probe:Drosophila_2:1629815_at:609:487; Interrogation_Position=89; Antisense; GTACCTCTTGTGGATCAGCTTACTT

Paste this into a BLAST search page for me
GAGAATCCCATGGATACGTGCGCCTTGACAAATCATTCGTCGTCTTTCCCGTCTTTCCCGAATGCCGACTAAAAGGAGATTCATCACTTACCGGAAGCTACGGATACCATCCGTTTCTATTTAATGAACACTGTCGCGTCCTAAGGTATCGGTATCCAAATCGTCTCAGAGTCTTGAGTCTTCTACTATTTCTACACCGCGCCTTTATGCCCTTTTCCAATATTAGGAACTGCACCTTGGATGATCGTATGATCGTATGTTTGCCAAGGTCCCATGGTGTCGTGAACTGGATTTCCATCAATTTGCCCTGATGAAGTACCTCTTGGTACCTCTTGTGGATCAGCTTACTT

Full Affymetrix probeset data:

Annotations for 1629815_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720