FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629820_at:

>probe:Drosophila_2:1629820_at:412:679; Interrogation_Position=1008; Antisense; TAGTGCAGCCACTTTGAGCTCTCAG
>probe:Drosophila_2:1629820_at:182:713; Interrogation_Position=1037; Antisense; TTCACTGCTTTGACTGGCATCCAGA
>probe:Drosophila_2:1629820_at:455:125; Interrogation_Position=1074; Antisense; AGCCGTCTGTGGAGCATTCGATCAA
>probe:Drosophila_2:1629820_at:25:257; Interrogation_Position=1096; Antisense; CAAAGCGTGCGCGTTTTAATTACCA
>probe:Drosophila_2:1629820_at:419:459; Interrogation_Position=606; Antisense; GATATTCGATTTGCGATCCCTTTCC
>probe:Drosophila_2:1629820_at:493:39; Interrogation_Position=661; Antisense; ATCTGTGGACTGGAGTTCGATCGCC
>probe:Drosophila_2:1629820_at:181:305; Interrogation_Position=684; Antisense; CCGGGACATTCCCATGAACAAGCTA
>probe:Drosophila_2:1629820_at:595:207; Interrogation_Position=703; Antisense; AAGCTAGCGGTCACCACTTTGGAGG
>probe:Drosophila_2:1629820_at:172:331; Interrogation_Position=728; Antisense; GCGGTCTCCTTGTCTTCGATATGAG
>probe:Drosophila_2:1629820_at:468:167; Interrogation_Position=819; Antisense; AAATGGCGTGATCAGCGGACCCAAA
>probe:Drosophila_2:1629820_at:279:131; Interrogation_Position=847; Antisense; ACCGTTTGGGTAGTTCGTCATCTGC
>probe:Drosophila_2:1629820_at:563:107; Interrogation_Position=875; Antisense; AGAATCGGGATCTCTTTCTCACGGG
>probe:Drosophila_2:1629820_at:730:583; Interrogation_Position=925; Antisense; TGGCAGTACGAGTATCCCGACAGGA
>probe:Drosophila_2:1629820_at:602:469; Interrogation_Position=985; Antisense; GTTGCTGGAGCCCTTAATATGCTTA

Paste this into a BLAST search page for me
TAGTGCAGCCACTTTGAGCTCTCAGTTCACTGCTTTGACTGGCATCCAGAAGCCGTCTGTGGAGCATTCGATCAACAAAGCGTGCGCGTTTTAATTACCAGATATTCGATTTGCGATCCCTTTCCATCTGTGGACTGGAGTTCGATCGCCCCGGGACATTCCCATGAACAAGCTAAAGCTAGCGGTCACCACTTTGGAGGGCGGTCTCCTTGTCTTCGATATGAGAAATGGCGTGATCAGCGGACCCAAAACCGTTTGGGTAGTTCGTCATCTGCAGAATCGGGATCTCTTTCTCACGGGTGGCAGTACGAGTATCCCGACAGGAGTTGCTGGAGCCCTTAATATGCTTA

Full Affymetrix probeset data:

Annotations for 1629820_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720