Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629821_at:

>probe:Drosophila_2:1629821_at:127:229; Interrogation_Position=1006; Antisense; AATGGCACAAACCAAACTCTCCGAC
>probe:Drosophila_2:1629821_at:219:269; Interrogation_Position=1034; Antisense; CAGGCGCCGCAGGAAGATCTGTCAT
>probe:Drosophila_2:1629821_at:11:453; Interrogation_Position=1049; Antisense; GATCTGTCATGGAATGCGGCACTAG
>probe:Drosophila_2:1629821_at:664:489; Interrogation_Position=1115; Antisense; GTAAAGAGGTTCCTGTCACACGGAC
>probe:Drosophila_2:1629821_at:483:495; Interrogation_Position=1129; Antisense; GTCACACGGACCCATTTCTATAAAA
>probe:Drosophila_2:1629821_at:709:457; Interrogation_Position=1169; Antisense; GATATTCGTACGTGTTCTGCAAATT
>probe:Drosophila_2:1629821_at:213:265; Interrogation_Position=1196; Antisense; CAGATGTTTTTAACTCTCTTGAGTC
>probe:Drosophila_2:1629821_at:244:203; Interrogation_Position=781; Antisense; AACCTTGCAGTTATCGATTCGTCTC
>probe:Drosophila_2:1629821_at:332:11; Interrogation_Position=797; Antisense; ATTCGTCTCGCTCATTGCGCAATGA
>probe:Drosophila_2:1629821_at:133:101; Interrogation_Position=850; Antisense; AGAGAGCCTCTCTCTTTGTGAGACA
>probe:Drosophila_2:1629821_at:526:73; Interrogation_Position=886; Antisense; AGGAAATGCAAATCCGCCTTCCACT
>probe:Drosophila_2:1629821_at:714:657; Interrogation_Position=944; Antisense; TAACTAGCTACTGGGTGCAGCGCAT
>probe:Drosophila_2:1629821_at:699:117; Interrogation_Position=962; Antisense; AGCGCATGTCCGAGGTGCACCAAAG
>probe:Drosophila_2:1629821_at:323:79; Interrogation_Position=974; Antisense; AGGTGCACCAAAGTCCCTGGACCAA

Paste this into a BLAST search page for me
AATGGCACAAACCAAACTCTCCGACCAGGCGCCGCAGGAAGATCTGTCATGATCTGTCATGGAATGCGGCACTAGGTAAAGAGGTTCCTGTCACACGGACGTCACACGGACCCATTTCTATAAAAGATATTCGTACGTGTTCTGCAAATTCAGATGTTTTTAACTCTCTTGAGTCAACCTTGCAGTTATCGATTCGTCTCATTCGTCTCGCTCATTGCGCAATGAAGAGAGCCTCTCTCTTTGTGAGACAAGGAAATGCAAATCCGCCTTCCACTTAACTAGCTACTGGGTGCAGCGCATAGCGCATGTCCGAGGTGCACCAAAGAGGTGCACCAAAGTCCCTGGACCAA

Full Affymetrix probeset data:

Annotations for 1629821_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime