FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629823_at:

>probe:Drosophila_2:1629823_at:49:57; Interrogation_Position=1052; Antisense; ATGACTCCGATGTTGCCGCGTAGTG
>probe:Drosophila_2:1629823_at:350:715; Interrogation_Position=1088; Antisense; TTCGGAGGCGTATTCGACGGCAACT
>probe:Drosophila_2:1629823_at:255:141; Interrogation_Position=1104; Antisense; ACGGCAACTATCAGGGTCCCAAGCT
>probe:Drosophila_2:1629823_at:444:689; Interrogation_Position=1128; Antisense; TATTCAGCCAGAGCGTGATGACCAA
>probe:Drosophila_2:1629823_at:76:443; Interrogation_Position=1144; Antisense; GATGACCAAGACTGTTCGCAAGCCG
>probe:Drosophila_2:1629823_at:403:475; Interrogation_Position=1193; Antisense; GTTACTCAGGATTCGTCTGGTCACA
>probe:Drosophila_2:1629823_at:379:171; Interrogation_Position=1253; Antisense; AAAGAGACCATTGTCACCCACGATG
>probe:Drosophila_2:1629823_at:35:445; Interrogation_Position=1274; Antisense; GATGACGGAGCTCCAACAGTTGGTA
>probe:Drosophila_2:1629823_at:482:459; Interrogation_Position=1331; Antisense; GATTTGGCCGTAGCTCGTGGCGAAC
>probe:Drosophila_2:1629823_at:661:181; Interrogation_Position=1372; Antisense; AAAAGAAGGCTACGCCATGCCACGG
>probe:Drosophila_2:1629823_at:72:49; Interrogation_Position=1388; Antisense; ATGCCACGGAACCTCTGGTGACCAG
>probe:Drosophila_2:1629823_at:302:535; Interrogation_Position=1414; Antisense; GGTGAACAACTATTGCCCCAATCAA
>probe:Drosophila_2:1629823_at:323:97; Interrogation_Position=1438; Antisense; AGATAAGCGATCTCTGCTGCAGCAA
>probe:Drosophila_2:1629823_at:210:175; Interrogation_Position=1495; Antisense; AAAGCGATTCGTCGGCAACATAGTC

Paste this into a BLAST search page for me
ATGACTCCGATGTTGCCGCGTAGTGTTCGGAGGCGTATTCGACGGCAACTACGGCAACTATCAGGGTCCCAAGCTTATTCAGCCAGAGCGTGATGACCAAGATGACCAAGACTGTTCGCAAGCCGGTTACTCAGGATTCGTCTGGTCACAAAAGAGACCATTGTCACCCACGATGGATGACGGAGCTCCAACAGTTGGTAGATTTGGCCGTAGCTCGTGGCGAACAAAAGAAGGCTACGCCATGCCACGGATGCCACGGAACCTCTGGTGACCAGGGTGAACAACTATTGCCCCAATCAAAGATAAGCGATCTCTGCTGCAGCAAAAAGCGATTCGTCGGCAACATAGTC

Full Affymetrix probeset data:

Annotations for 1629823_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720