FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629824_at:

>probe:Drosophila_2:1629824_at:252:63; Interrogation_Position=13; Antisense; ATGTGCAAGTTCACCAACCGGCTGT
>probe:Drosophila_2:1629824_at:533:325; Interrogation_Position=131; Antisense; GCGACTTGCTGGACGTCTTATACGA
>probe:Drosophila_2:1629824_at:213:541; Interrogation_Position=172; Antisense; GGTTTTCAGCGCGAGGACATTCTAT
>probe:Drosophila_2:1629824_at:86:557; Interrogation_Position=186; Antisense; GGACATTCTATACGACCAACGGCAA
>probe:Drosophila_2:1629824_at:452:501; Interrogation_Position=247; Antisense; GTCGTCATCGGAATGGCGCCTCAAA
>probe:Drosophila_2:1629824_at:22:613; Interrogation_Position=315; Antisense; TGAAATGTTGTTGCGCCAATCTACA
>probe:Drosophila_2:1629824_at:279:665; Interrogation_Position=336; Antisense; TACACCGGATCCAGATTCAACTCAG
>probe:Drosophila_2:1629824_at:440:81; Interrogation_Position=370; Antisense; AGGGATCCTGAGACCGACACAGACT
>probe:Drosophila_2:1629824_at:171:583; Interrogation_Position=396; Antisense; TGGTTCCACCGAGGGCGTAACTAAG
>probe:Drosophila_2:1629824_at:175:659; Interrogation_Position=417; Antisense; TAAGATTCCTGAGCTAGCCCAGATT
>probe:Drosophila_2:1629824_at:675:3; Interrogation_Position=466; Antisense; ATTGTAGCTTCTCAAACTGCCAGCC
>probe:Drosophila_2:1629824_at:183:307; Interrogation_Position=48; Antisense; CCTGCTGCTTGTGGCACTTGGAAGA
>probe:Drosophila_2:1629824_at:617:253; Interrogation_Position=497; Antisense; CAACTCAACTGCTCCAATTGCTTAA
>probe:Drosophila_2:1629824_at:196:147; Interrogation_Position=63; Antisense; ACTTGGAAGAATTCTGGCCCAGCCC

Paste this into a BLAST search page for me
ATGTGCAAGTTCACCAACCGGCTGTGCGACTTGCTGGACGTCTTATACGAGGTTTTCAGCGCGAGGACATTCTATGGACATTCTATACGACCAACGGCAAGTCGTCATCGGAATGGCGCCTCAAATGAAATGTTGTTGCGCCAATCTACATACACCGGATCCAGATTCAACTCAGAGGGATCCTGAGACCGACACAGACTTGGTTCCACCGAGGGCGTAACTAAGTAAGATTCCTGAGCTAGCCCAGATTATTGTAGCTTCTCAAACTGCCAGCCCCTGCTGCTTGTGGCACTTGGAAGACAACTCAACTGCTCCAATTGCTTAAACTTGGAAGAATTCTGGCCCAGCCC

Full Affymetrix probeset data:

Annotations for 1629824_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720