FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629828_at:

>probe:Drosophila_2:1629828_at:491:575; Interrogation_Position=339; Antisense; GGCGATGCGAGCTCTTTCCATATCC
>probe:Drosophila_2:1629828_at:219:575; Interrogation_Position=366; Antisense; GGCGGATGCTTTTATTCTGGTCTAC
>probe:Drosophila_2:1629828_at:550:589; Interrogation_Position=383; Antisense; TGGTCTACGACGTAACCGATGCCAC
>probe:Drosophila_2:1629828_at:385:435; Interrogation_Position=418; Antisense; GAGGTGCGCACAATTCGCGATCAGA
>probe:Drosophila_2:1629828_at:483:97; Interrogation_Position=440; Antisense; AGATCCACGAGACTAAGGCCACTAC
>probe:Drosophila_2:1629828_at:103:133; Interrogation_Position=463; Antisense; ACCGCTGTTCCAATTGTAGTTGTCG
>probe:Drosophila_2:1629828_at:452:425; Interrogation_Position=527; Antisense; GAGAGGTTGAGTACGCCACCACAGA
>probe:Drosophila_2:1629828_at:85:107; Interrogation_Position=549; Antisense; AGAATCGGTTGTTACTGTGGACTGG
>probe:Drosophila_2:1629828_at:26:487; Interrogation_Position=586; Antisense; GTAGAGGCTTCAGCTTCCAGTAATG
>probe:Drosophila_2:1629828_at:178:473; Interrogation_Position=627; Antisense; GTTCAAGGAACTGCTAGCCCAGGCA
>probe:Drosophila_2:1629828_at:444:29; Interrogation_Position=655; Antisense; ATAACTTACAATCTGAGTCCGGCCC
>probe:Drosophila_2:1629828_at:323:267; Interrogation_Position=694; Antisense; CAGTCGTTGCCGCAGCAGATTGGTA
>probe:Drosophila_2:1629828_at:474:629; Interrogation_Position=884; Antisense; TCCAGGAGCGAAGCTTGGGCGCCAA
>probe:Drosophila_2:1629828_at:99:177; Interrogation_Position=907; Antisense; AAACGCAACTCGTGCATCATTTCCT

Paste this into a BLAST search page for me
GGCGATGCGAGCTCTTTCCATATCCGGCGGATGCTTTTATTCTGGTCTACTGGTCTACGACGTAACCGATGCCACGAGGTGCGCACAATTCGCGATCAGAAGATCCACGAGACTAAGGCCACTACACCGCTGTTCCAATTGTAGTTGTCGGAGAGGTTGAGTACGCCACCACAGAAGAATCGGTTGTTACTGTGGACTGGGTAGAGGCTTCAGCTTCCAGTAATGGTTCAAGGAACTGCTAGCCCAGGCAATAACTTACAATCTGAGTCCGGCCCCAGTCGTTGCCGCAGCAGATTGGTATCCAGGAGCGAAGCTTGGGCGCCAAAAACGCAACTCGTGCATCATTTCCT

Full Affymetrix probeset data:

Annotations for 1629828_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720