FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629829_at:

>probe:Drosophila_2:1629829_at:197:689; Interrogation_Position=112; Antisense; TTCTCCGAAACACCTAAACGTTGCG
>probe:Drosophila_2:1629829_at:256:177; Interrogation_Position=127; Antisense; AAACGTTGCGTACGATTGCGCCAGC
>probe:Drosophila_2:1629829_at:271:311; Interrogation_Position=146; Antisense; GCCAGCAAAAGTTGTTCGCGAACGA
>probe:Drosophila_2:1629829_at:716:379; Interrogation_Position=165; Antisense; GAACGATACCGCGAGTTTTGTGATA
>probe:Drosophila_2:1629829_at:365:91; Interrogation_Position=178; Antisense; AGTTTTGTGATAGGTCGCCGTTCGC
>probe:Drosophila_2:1629829_at:593:367; Interrogation_Position=211; Antisense; GAATCCAAAATCGATCTCAACAGAG
>probe:Drosophila_2:1629829_at:497:463; Interrogation_Position=22; Antisense; GATTCCACGCTGTACTTCAGTGCCG
>probe:Drosophila_2:1629829_at:375:427; Interrogation_Position=233; Antisense; GAGATGTATCTCCTGGAAGGCGAAA
>probe:Drosophila_2:1629829_at:323:419; Interrogation_Position=259; Antisense; GAGCTGCGCGGCGAGGAAATCCTTC
>probe:Drosophila_2:1629829_at:208:393; Interrogation_Position=274; Antisense; GAAATCCTTCGGATGCGCAAGGATC
>probe:Drosophila_2:1629829_at:568:163; Interrogation_Position=305; Antisense; AAAAGGAGCGTCTGAGGCCCCAAAG
>probe:Drosophila_2:1629829_at:489:169; Interrogation_Position=326; Antisense; AAAGGCGTCTTACCATGCGGATTTA
>probe:Drosophila_2:1629829_at:71:711; Interrogation_Position=37; Antisense; TTCAGTGCCGTCGAGGATATGTTCA
>probe:Drosophila_2:1629829_at:240:333; Interrogation_Position=96; Antisense; TCCTGGAAACGAGGATTTCTCCGAA

Paste this into a BLAST search page for me
TTCTCCGAAACACCTAAACGTTGCGAAACGTTGCGTACGATTGCGCCAGCGCCAGCAAAAGTTGTTCGCGAACGAGAACGATACCGCGAGTTTTGTGATAAGTTTTGTGATAGGTCGCCGTTCGCGAATCCAAAATCGATCTCAACAGAGGATTCCACGCTGTACTTCAGTGCCGGAGATGTATCTCCTGGAAGGCGAAAGAGCTGCGCGGCGAGGAAATCCTTCGAAATCCTTCGGATGCGCAAGGATCAAAAGGAGCGTCTGAGGCCCCAAAGAAAGGCGTCTTACCATGCGGATTTATTCAGTGCCGTCGAGGATATGTTCATCCTGGAAACGAGGATTTCTCCGAA

Full Affymetrix probeset data:

Annotations for 1629829_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720