FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629830_at:

>probe:Drosophila_2:1629830_at:361:541; Interrogation_Position=1076; Antisense; GGTTCCGTAAGATGCTGCTCTACTA
>probe:Drosophila_2:1629830_at:244:611; Interrogation_Position=1130; Antisense; TGACCGCCATGAAGCTGTTTCCCAT
>probe:Drosophila_2:1629830_at:585:237; Interrogation_Position=1156; Antisense; AATCTGGCCACGTACTTCAGTATAG
>probe:Drosophila_2:1629830_at:259:89; Interrogation_Position=1174; Antisense; AGTATAGCCAAGTTCTCGTTTTCGC
>probe:Drosophila_2:1629830_at:399:695; Interrogation_Position=1193; Antisense; TTTCGCTCTACACGCTCATCAAGGG
>probe:Drosophila_2:1629830_at:664:281; Interrogation_Position=1225; Antisense; CTCGGCGAGCGATTCAACAGGACAA
>probe:Drosophila_2:1629830_at:276:485; Interrogation_Position=660; Antisense; GTATGTGGTCCGGATTCAAGTGCAA
>probe:Drosophila_2:1629830_at:658:653; Interrogation_Position=675; Antisense; TCAAGTGCAATTGCTGGCCAGGCGG
>probe:Drosophila_2:1629830_at:197:353; Interrogation_Position=783; Antisense; GCAGCGCTGCATTGTAGATCACCAG
>probe:Drosophila_2:1629830_at:728:619; Interrogation_Position=821; Antisense; TGCTCGACTGCATTAGTCCCGTCAT
>probe:Drosophila_2:1629830_at:610:487; Interrogation_Position=851; Antisense; GTACCATATTCGTTCAGTTCCTGAT
>probe:Drosophila_2:1629830_at:104:191; Interrogation_Position=907; Antisense; AACATTTTCATTTTCGCCAATACGA
>probe:Drosophila_2:1629830_at:212:451; Interrogation_Position=939; Antisense; GATCGCATCGATCATTTACCTGCTG
>probe:Drosophila_2:1629830_at:411:69; Interrogation_Position=998; Antisense; AGGCCACCTCGCTGATGTTGGACAA

Paste this into a BLAST search page for me
GGTTCCGTAAGATGCTGCTCTACTATGACCGCCATGAAGCTGTTTCCCATAATCTGGCCACGTACTTCAGTATAGAGTATAGCCAAGTTCTCGTTTTCGCTTTCGCTCTACACGCTCATCAAGGGCTCGGCGAGCGATTCAACAGGACAAGTATGTGGTCCGGATTCAAGTGCAATCAAGTGCAATTGCTGGCCAGGCGGGCAGCGCTGCATTGTAGATCACCAGTGCTCGACTGCATTAGTCCCGTCATGTACCATATTCGTTCAGTTCCTGATAACATTTTCATTTTCGCCAATACGAGATCGCATCGATCATTTACCTGCTGAGGCCACCTCGCTGATGTTGGACAA

Full Affymetrix probeset data:

Annotations for 1629830_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720