FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629831_at:

>probe:Drosophila_2:1629831_at:254:617; Interrogation_Position=1038; Antisense; TGCACTCAGGTCTTAAGCCCTTTGA
>probe:Drosophila_2:1629831_at:97:425; Interrogation_Position=598; Antisense; GAGACTACTTACAACGTATCCCTCT
>probe:Drosophila_2:1629831_at:703:485; Interrogation_Position=629; Antisense; GTAGTAAAGCCCCTTGCATTAGCTC
>probe:Drosophila_2:1629831_at:579:441; Interrogation_Position=659; Antisense; GATGTGGCAGCTGAGAATGTACCCC
>probe:Drosophila_2:1629831_at:527:183; Interrogation_Position=704; Antisense; AAAATGCAATCCCTGGTGTGCCCTA
>probe:Drosophila_2:1629831_at:149:25; Interrogation_Position=771; Antisense; ATATGGTGCGCCACACGGGTGAGAA
>probe:Drosophila_2:1629831_at:433:693; Interrogation_Position=800; Antisense; TTTCCATGCACGTTCTGCGACAAGC
>probe:Drosophila_2:1629831_at:544:325; Interrogation_Position=816; Antisense; GCGACAAGCGGTTCGTCACCAAGTA
>probe:Drosophila_2:1629831_at:726:249; Interrogation_Position=835; Antisense; CAAGTATCTGGCTCGTCTACACGAA
>probe:Drosophila_2:1629831_at:244:665; Interrogation_Position=852; Antisense; TACACGAACGAGTGCGCCACATGGG
>probe:Drosophila_2:1629831_at:646:323; Interrogation_Position=876; Antisense; GCGAACAGCCGTTTGAGTGCAACTT
>probe:Drosophila_2:1629831_at:352:85; Interrogation_Position=891; Antisense; AGTGCAACTTCTGCTCGGCAACGTT
>probe:Drosophila_2:1629831_at:488:415; Interrogation_Position=944; Antisense; GAGCGAATACGGCACATCAGAGATC
>probe:Drosophila_2:1629831_at:34:327; Interrogation_Position=981; Antisense; GCGACCAGTGCACCAAGAGATTCAA

Paste this into a BLAST search page for me
TGCACTCAGGTCTTAAGCCCTTTGAGAGACTACTTACAACGTATCCCTCTGTAGTAAAGCCCCTTGCATTAGCTCGATGTGGCAGCTGAGAATGTACCCCAAAATGCAATCCCTGGTGTGCCCTAATATGGTGCGCCACACGGGTGAGAATTTCCATGCACGTTCTGCGACAAGCGCGACAAGCGGTTCGTCACCAAGTACAAGTATCTGGCTCGTCTACACGAATACACGAACGAGTGCGCCACATGGGGCGAACAGCCGTTTGAGTGCAACTTAGTGCAACTTCTGCTCGGCAACGTTGAGCGAATACGGCACATCAGAGATCGCGACCAGTGCACCAAGAGATTCAA

Full Affymetrix probeset data:

Annotations for 1629831_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720