FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629835_at:

>probe:Drosophila_2:1629835_at:594:147; Interrogation_Position=483; Antisense; ACTTGAATCGCGGAAGACTCCCGAG
>probe:Drosophila_2:1629835_at:633:365; Interrogation_Position=498; Antisense; GACTCCCGAGTATACGATGACCTAT
>probe:Drosophila_2:1629835_at:272:57; Interrogation_Position=514; Antisense; ATGACCTATCGCCAAGCAGTGGGCA
>probe:Drosophila_2:1629835_at:310:437; Interrogation_Position=541; Antisense; GAGGATGTCTTCTTGCAGATGGGCA
>probe:Drosophila_2:1629835_at:520:265; Interrogation_Position=556; Antisense; CAGATGGGCAATCGCACTGGATCCT
>probe:Drosophila_2:1629835_at:352:639; Interrogation_Position=580; Antisense; TCGGCCAGCTGTGAGGACCTCATTT
>probe:Drosophila_2:1629835_at:178:645; Interrogation_Position=599; Antisense; TCATTTTGGAGGTTTCCCTGCCGGA
>probe:Drosophila_2:1629835_at:475:167; Interrogation_Position=644; Antisense; AAATGTCGCTCAGCTTGCAGGAAAC
>probe:Drosophila_2:1629835_at:573:667; Interrogation_Position=684; Antisense; TACATGTTTGTACCGCTTACGCTTA
>probe:Drosophila_2:1629835_at:36:45; Interrogation_Position=719; Antisense; ATCCCGTCAATGTTGATCGTTGTCA
>probe:Drosophila_2:1629835_at:94:335; Interrogation_Position=762; Antisense; GCTGAAGAAACTACGGCTCACTCTG
>probe:Drosophila_2:1629835_at:164:317; Interrogation_Position=788; Antisense; GCCTGCAGCGCGAACTAGACTATGT
>probe:Drosophila_2:1629835_at:647:479; Interrogation_Position=923; Antisense; GTTTGCATCGTTTGCTTAGATACAA
>probe:Drosophila_2:1629835_at:251:69; Interrogation_Position=970; Antisense; ATGGCCATTTACTTTGTGTATCAGG

Paste this into a BLAST search page for me
ACTTGAATCGCGGAAGACTCCCGAGGACTCCCGAGTATACGATGACCTATATGACCTATCGCCAAGCAGTGGGCAGAGGATGTCTTCTTGCAGATGGGCACAGATGGGCAATCGCACTGGATCCTTCGGCCAGCTGTGAGGACCTCATTTTCATTTTGGAGGTTTCCCTGCCGGAAAATGTCGCTCAGCTTGCAGGAAACTACATGTTTGTACCGCTTACGCTTAATCCCGTCAATGTTGATCGTTGTCAGCTGAAGAAACTACGGCTCACTCTGGCCTGCAGCGCGAACTAGACTATGTGTTTGCATCGTTTGCTTAGATACAAATGGCCATTTACTTTGTGTATCAGG

Full Affymetrix probeset data:

Annotations for 1629835_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720