FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629836_at:

>probe:Drosophila_2:1629836_at:355:459; Interrogation_Position=1003; Antisense; GATTTGGAGAACACACCCGGTAACT
>probe:Drosophila_2:1629836_at:442:277; Interrogation_Position=1020; Antisense; CGGTAACTCCTCCAATATTCTTTAT
>probe:Drosophila_2:1629836_at:18:645; Interrogation_Position=1038; Antisense; TCTTTATAAGAACTGGCTGCCCCAA
>probe:Drosophila_2:1629836_at:504:177; Interrogation_Position=1090; Antisense; AAACTCTTTATCACACACGCTGGAA
>probe:Drosophila_2:1629836_at:5:221; Interrogation_Position=1114; Antisense; AAGGGCGGCATTACGGAGGCACAAT
>probe:Drosophila_2:1629836_at:579:229; Interrogation_Position=1152; Antisense; AATGGTGGCACTGCCGATATTCGGA
>probe:Drosophila_2:1629836_at:504:165; Interrogation_Position=1207; Antisense; AAATCTGGATATGGCCTGGCTCTGG
>probe:Drosophila_2:1629836_at:496:287; Interrogation_Position=1222; Antisense; CTGGCTCTGGATTTGCTGTCCATAA
>probe:Drosophila_2:1629836_at:522:207; Interrogation_Position=1304; Antisense; AAGCTATTGGCCAATTCTCTACCCT
>probe:Drosophila_2:1629836_at:252:673; Interrogation_Position=1323; Antisense; TACCCTGTACAGAGATCGACCCATG
>probe:Drosophila_2:1629836_at:188:55; Interrogation_Position=1345; Antisense; ATGACCGCCAAGCAGTCGGTGGTTT
>probe:Drosophila_2:1629836_at:451:253; Interrogation_Position=1407; Antisense; CAACTTACAGAGTCCGTCGGTGCAC
>probe:Drosophila_2:1629836_at:549:463; Interrogation_Position=1482; Antisense; GATTCTGGTCTTATTTGTGCTCCTT
>probe:Drosophila_2:1629836_at:2:629; Interrogation_Position=1502; Antisense; TCCTTACCCGACTGGTTGCGAAAAT

Paste this into a BLAST search page for me
GATTTGGAGAACACACCCGGTAACTCGGTAACTCCTCCAATATTCTTTATTCTTTATAAGAACTGGCTGCCCCAAAAACTCTTTATCACACACGCTGGAAAAGGGCGGCATTACGGAGGCACAATAATGGTGGCACTGCCGATATTCGGAAAATCTGGATATGGCCTGGCTCTGGCTGGCTCTGGATTTGCTGTCCATAAAAGCTATTGGCCAATTCTCTACCCTTACCCTGTACAGAGATCGACCCATGATGACCGCCAAGCAGTCGGTGGTTTCAACTTACAGAGTCCGTCGGTGCACGATTCTGGTCTTATTTGTGCTCCTTTCCTTACCCGACTGGTTGCGAAAAT

Full Affymetrix probeset data:

Annotations for 1629836_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720