FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629837_at:

>probe:Drosophila_2:1629837_at:622:109; Interrogation_Position=2021; Antisense; AGAATGACTTCTCCATCTGTCGCTA
>probe:Drosophila_2:1629837_at:469:531; Interrogation_Position=2115; Antisense; GGTGGTGTCCATTGCCTACAAGGGC
>probe:Drosophila_2:1629837_at:96:279; Interrogation_Position=2130; Antisense; CTACAAGGGCTACTGGTCGGATCTG
>probe:Drosophila_2:1629837_at:529:275; Interrogation_Position=2152; Antisense; CTGTCGGAGCTCTGGTTCCTGGGAA
>probe:Drosophila_2:1629837_at:13:233; Interrogation_Position=2175; Antisense; AATGCAGACCATGTGCGGCGTGCTA
>probe:Drosophila_2:1629837_at:531:181; Interrogation_Position=2270; Antisense; AAAAGGTCAAGATCGGCACCCTGCC
>probe:Drosophila_2:1629837_at:73:665; Interrogation_Position=2304; Antisense; TAAATCCGCGTACGAGGACTTCCTG
>probe:Drosophila_2:1629837_at:261:1; Interrogation_Position=2324; Antisense; TCCTGTCCCAACTGGTGGACGTGAA
>probe:Drosophila_2:1629837_at:23:443; Interrogation_Position=2353; Antisense; GATGTCCAGGCCGTGCTCAAGAAGG
>probe:Drosophila_2:1629837_at:671:651; Interrogation_Position=2369; Antisense; TCAAGAAGGCCGATGCTCTGCGGGT
>probe:Drosophila_2:1629837_at:570:531; Interrogation_Position=2390; Antisense; GGGTCTGCCGCAATCACAGGATGAT
>probe:Drosophila_2:1629837_at:593:521; Interrogation_Position=2421; Antisense; GGGCAAGAAGCTCTTCGGCGACTAA
>probe:Drosophila_2:1629837_at:399:225; Interrogation_Position=2453; Antisense; AAGGCACTCACTGTTTCTCTAGAGG
>probe:Drosophila_2:1629837_at:584:595; Interrogation_Position=2485; Antisense; TGTGTGTGATTTGTGCGCCAGCGAA

Paste this into a BLAST search page for me
AGAATGACTTCTCCATCTGTCGCTAGGTGGTGTCCATTGCCTACAAGGGCCTACAAGGGCTACTGGTCGGATCTGCTGTCGGAGCTCTGGTTCCTGGGAAAATGCAGACCATGTGCGGCGTGCTAAAAAGGTCAAGATCGGCACCCTGCCTAAATCCGCGTACGAGGACTTCCTGTCCTGTCCCAACTGGTGGACGTGAAGATGTCCAGGCCGTGCTCAAGAAGGTCAAGAAGGCCGATGCTCTGCGGGTGGGTCTGCCGCAATCACAGGATGATGGGCAAGAAGCTCTTCGGCGACTAAAAGGCACTCACTGTTTCTCTAGAGGTGTGTGTGATTTGTGCGCCAGCGAA

Full Affymetrix probeset data:

Annotations for 1629837_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720