FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629838_at:

>probe:Drosophila_2:1629838_at:522:469; Interrogation_Position=1032; Antisense; GTTGCGGATCGATACTGCGTTGCGT
>probe:Drosophila_2:1629838_at:652:533; Interrogation_Position=1063; Antisense; GGTAGAGTTCGTCTTCCAGGACAAT
>probe:Drosophila_2:1629838_at:525:73; Interrogation_Position=1080; Antisense; AGGACAATGAAACCAGCCGCGATAA
>probe:Drosophila_2:1629838_at:578:261; Interrogation_Position=1132; Antisense; CACCATGCAGGTATCGTATCTACTA
>probe:Drosophila_2:1629838_at:298:127; Interrogation_Position=1215; Antisense; AGCCAGCTCGAGAACTGCTCAATTG
>probe:Drosophila_2:1629838_at:52:467; Interrogation_Position=1277; Antisense; GTTGGCCTGCTGATCGTTTCATCGA
>probe:Drosophila_2:1629838_at:621:439; Interrogation_Position=1300; Antisense; GATGGCCCATTTCGGAAGCACTTTC
>probe:Drosophila_2:1629838_at:210:635; Interrogation_Position=1339; Antisense; TCGCACTGGCTTCTACGTATTCAAG
>probe:Drosophila_2:1629838_at:674:147; Interrogation_Position=1407; Antisense; ACTATCCATATCCTGTGACCTTGAA
>probe:Drosophila_2:1629838_at:228:195; Interrogation_Position=1430; Antisense; AACTGCAGCAGAGCTCTGTTGCCGA
>probe:Drosophila_2:1629838_at:596:469; Interrogation_Position=1447; Antisense; GTTGCCGACTTCAGTTCGATATTCC
>probe:Drosophila_2:1629838_at:173:459; Interrogation_Position=1464; Antisense; GATATTCCACTGCAGTCGGCAACAG
>probe:Drosophila_2:1629838_at:389:171; Interrogation_Position=955; Antisense; AAAGTATCTGGAGCTAACCTGCGAT
>probe:Drosophila_2:1629838_at:444:325; Interrogation_Position=975; Antisense; GCGATATCAATGAAGCCCTGGCCAG

Paste this into a BLAST search page for me
GTTGCGGATCGATACTGCGTTGCGTGGTAGAGTTCGTCTTCCAGGACAATAGGACAATGAAACCAGCCGCGATAACACCATGCAGGTATCGTATCTACTAAGCCAGCTCGAGAACTGCTCAATTGGTTGGCCTGCTGATCGTTTCATCGAGATGGCCCATTTCGGAAGCACTTTCTCGCACTGGCTTCTACGTATTCAAGACTATCCATATCCTGTGACCTTGAAAACTGCAGCAGAGCTCTGTTGCCGAGTTGCCGACTTCAGTTCGATATTCCGATATTCCACTGCAGTCGGCAACAGAAAGTATCTGGAGCTAACCTGCGATGCGATATCAATGAAGCCCTGGCCAG

Full Affymetrix probeset data:

Annotations for 1629838_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720