FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629841_at:

>probe:Drosophila_2:1629841_at:351:375; Interrogation_Position=330; Antisense; GAAGATCGTGGAGCTGACCACCAAC
>probe:Drosophila_2:1629841_at:277:251; Interrogation_Position=366; Antisense; CAAGCGCAATATGTTGGGTGCCAAC
>probe:Drosophila_2:1629841_at:412:437; Interrogation_Position=436; Antisense; GAGGACGAAGCCGACCAGGCCAATA
>probe:Drosophila_2:1629841_at:16:79; Interrogation_Position=460; Antisense; AGGATACCCGGCATGGATTTCGATC
>probe:Drosophila_2:1629841_at:160:413; Interrogation_Position=526; Antisense; GAGCCGAAGGCCACAAAGTCCAACA
>probe:Drosophila_2:1629841_at:83:261; Interrogation_Position=555; Antisense; CACGCTGCCGGACATCAAGAGCAAA
>probe:Drosophila_2:1629841_at:566:169; Interrogation_Position=579; Antisense; AAAGGATCTCGACCGCCTGATGAAG
>probe:Drosophila_2:1629841_at:162:107; Interrogation_Position=677; Antisense; AGAAGAAGGCCAAGCGGGACCGCAA
>probe:Drosophila_2:1629841_at:17:529; Interrogation_Position=692; Antisense; GGGACCGCAACAACACCATCAAGAG
>probe:Drosophila_2:1629841_at:329:33; Interrogation_Position=709; Antisense; ATCAAGAGCGTTCCCAAGCATCAGC
>probe:Drosophila_2:1629841_at:242:113; Interrogation_Position=737; Antisense; AGCAGCTCAAGTACGGAAAGGCCAA
>probe:Drosophila_2:1629841_at:634:393; Interrogation_Position=752; Antisense; GAAAGGCCAACCAGACCAAATACCG
>probe:Drosophila_2:1629841_at:524:195; Interrogation_Position=815; Antisense; AACGGAATGCCGACTAAATTTAGCT
>probe:Drosophila_2:1629841_at:334:663; Interrogation_Position=891; Antisense; TAAACTGTATAATTCCTGGCTTGTA

Paste this into a BLAST search page for me
GAAGATCGTGGAGCTGACCACCAACCAAGCGCAATATGTTGGGTGCCAACGAGGACGAAGCCGACCAGGCCAATAAGGATACCCGGCATGGATTTCGATCGAGCCGAAGGCCACAAAGTCCAACACACGCTGCCGGACATCAAGAGCAAAAAAGGATCTCGACCGCCTGATGAAGAGAAGAAGGCCAAGCGGGACCGCAAGGGACCGCAACAACACCATCAAGAGATCAAGAGCGTTCCCAAGCATCAGCAGCAGCTCAAGTACGGAAAGGCCAAGAAAGGCCAACCAGACCAAATACCGAACGGAATGCCGACTAAATTTAGCTTAAACTGTATAATTCCTGGCTTGTA

Full Affymetrix probeset data:

Annotations for 1629841_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720