FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629845_at:

>probe:Drosophila_2:1629845_at:281:337; Interrogation_Position=1018; Antisense; GCTGCCAAGTGCGAGGTGACCATCA
>probe:Drosophila_2:1629845_at:105:155; Interrogation_Position=470; Antisense; ACAGTTACCAACTTGGCCAGCCAGT
>probe:Drosophila_2:1629845_at:595:261; Interrogation_Position=487; Antisense; CAGCCAGTGGCCAACAAATTGTCAA
>probe:Drosophila_2:1629845_at:209:249; Interrogation_Position=503; Antisense; AATTGTCAACAGTCGCGATGCAGGC
>probe:Drosophila_2:1629845_at:81:385; Interrogation_Position=543; Antisense; GAACTCGGGAGGTGCATCCTTATCA
>probe:Drosophila_2:1629845_at:75:469; Interrogation_Position=657; Antisense; GTTGCGACATTTGAGCGGCGACCAC
>probe:Drosophila_2:1629845_at:222:129; Interrogation_Position=677; Antisense; ACCACCGGCTGGCAGTGTTGCAAAT
>probe:Drosophila_2:1629845_at:96:309; Interrogation_Position=696; Antisense; GCAAATCTACGGCACGTTCGGCGAA
>probe:Drosophila_2:1629845_at:300:149; Interrogation_Position=790; Antisense; ACTTTTGGCCACGTCAGAGTGCACA
>probe:Drosophila_2:1629845_at:109:433; Interrogation_Position=806; Antisense; GAGTGCACACATTTTTCTTGGCTGT
>probe:Drosophila_2:1629845_at:597:697; Interrogation_Position=819; Antisense; TTTCTTGGCTGTCATTGCGATCGGC
>probe:Drosophila_2:1629845_at:464:65; Interrogation_Position=893; Antisense; ATGGACCCACTTTCGAGACTGTCAT
>probe:Drosophila_2:1629845_at:145:103; Interrogation_Position=908; Antisense; AGACTGTCATCGAGACTCCGGGCCA
>probe:Drosophila_2:1629845_at:47:551; Interrogation_Position=975; Antisense; GGAGATTAGGGCATCCGGCCAGTTC

Paste this into a BLAST search page for me
GCTGCCAAGTGCGAGGTGACCATCAACAGTTACCAACTTGGCCAGCCAGTCAGCCAGTGGCCAACAAATTGTCAAAATTGTCAACAGTCGCGATGCAGGCGAACTCGGGAGGTGCATCCTTATCAGTTGCGACATTTGAGCGGCGACCACACCACCGGCTGGCAGTGTTGCAAATGCAAATCTACGGCACGTTCGGCGAAACTTTTGGCCACGTCAGAGTGCACAGAGTGCACACATTTTTCTTGGCTGTTTTCTTGGCTGTCATTGCGATCGGCATGGACCCACTTTCGAGACTGTCATAGACTGTCATCGAGACTCCGGGCCAGGAGATTAGGGCATCCGGCCAGTTC

Full Affymetrix probeset data:

Annotations for 1629845_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720