Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629846_at:

>probe:Drosophila_2:1629846_at:231:229; Interrogation_Position=1518; Antisense; AATGGCTTCTGGTGTGCCGGAATCC
>probe:Drosophila_2:1629846_at:681:625; Interrogation_Position=1532; Antisense; TGCCGGAATCCACCCAGAGTTTGAA
>probe:Drosophila_2:1629846_at:14:629; Interrogation_Position=1614; Antisense; TCCACTAATCTTCGCCAGCTTTGAT
>probe:Drosophila_2:1629846_at:669:115; Interrogation_Position=1670; Antisense; AGCATGTCTTCCCTGTGATTCTGAT
>probe:Drosophila_2:1629846_at:54:609; Interrogation_Position=1736; Antisense; TGAGGGCACAGAGTTTCCAGCAAGC
>probe:Drosophila_2:1629846_at:515:33; Interrogation_Position=1762; Antisense; ATCAACTTCGTTCAGTCCGCAGAAA
>probe:Drosophila_2:1629846_at:633:383; Interrogation_Position=1793; Antisense; GAACAGCTCTGCACGTGGAAAACTT
>probe:Drosophila_2:1629846_at:499:111; Interrogation_Position=1832; Antisense; AGCAAGTCAACTTGGCCTTGGATCT
>probe:Drosophila_2:1629846_at:632:695; Interrogation_Position=1915; Antisense; TTTAGAGCTCTGGATGTGACGGGTC
>probe:Drosophila_2:1629846_at:109:611; Interrogation_Position=1931; Antisense; TGACGGGTCTGATTTACGATCACAT
>probe:Drosophila_2:1629846_at:76:141; Interrogation_Position=1952; Antisense; ACATGGATCGAGTGGGTCCGTTCGC
>probe:Drosophila_2:1629846_at:642:501; Interrogation_Position=1967; Antisense; GTCCGTTCGCTTGGAAACGATCCGA
>probe:Drosophila_2:1629846_at:668:523; Interrogation_Position=2000; Antisense; GGGCCCCACAACTTATGGAACTATT
>probe:Drosophila_2:1629846_at:96:391; Interrogation_Position=2048; Antisense; GAAACTCGACGACCATTCCGGGAAT

Paste this into a BLAST search page for me
AATGGCTTCTGGTGTGCCGGAATCCTGCCGGAATCCACCCAGAGTTTGAATCCACTAATCTTCGCCAGCTTTGATAGCATGTCTTCCCTGTGATTCTGATTGAGGGCACAGAGTTTCCAGCAAGCATCAACTTCGTTCAGTCCGCAGAAAGAACAGCTCTGCACGTGGAAAACTTAGCAAGTCAACTTGGCCTTGGATCTTTTAGAGCTCTGGATGTGACGGGTCTGACGGGTCTGATTTACGATCACATACATGGATCGAGTGGGTCCGTTCGCGTCCGTTCGCTTGGAAACGATCCGAGGGCCCCACAACTTATGGAACTATTGAAACTCGACGACCATTCCGGGAAT

Full Affymetrix probeset data:

Annotations for 1629846_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime