Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629847_at:

>probe:Drosophila_2:1629847_at:513:701; Interrogation_Position=1913; Antisense; TTATGTCCCTGGTCGAAAGTTCCTT
>probe:Drosophila_2:1629847_at:136:93; Interrogation_Position=1930; Antisense; AGTTCCTTTTCAATCTACCCAAATG
>probe:Drosophila_2:1629847_at:142:665; Interrogation_Position=1945; Antisense; TACCCAAATGTGCACCCGAGTACTG
>probe:Drosophila_2:1629847_at:519:429; Interrogation_Position=1962; Antisense; GAGTACTGCACATCTCTGGATCAGT
>probe:Drosophila_2:1629847_at:233:589; Interrogation_Position=1978; Antisense; TGGATCAGTCGTGGTGCAGTACCCA
>probe:Drosophila_2:1629847_at:203:125; Interrogation_Position=2044; Antisense; AGCCACACAGTTGCAACCCGGAATA
>probe:Drosophila_2:1629847_at:304:241; Interrogation_Position=2065; Antisense; AATACGAGTCACAACTGTCGCGCTT
>probe:Drosophila_2:1629847_at:207:599; Interrogation_Position=2080; Antisense; TGTCGCGCTTTACTCAATTTGCAGT
>probe:Drosophila_2:1629847_at:672:381; Interrogation_Position=2144; Antisense; GAACGACATGAACGCTGACCAGGAT
>probe:Drosophila_2:1629847_at:222:333; Interrogation_Position=2169; Antisense; GCTGGCCAGGGCAACTCAACTGATA
>probe:Drosophila_2:1629847_at:426:191; Interrogation_Position=2271; Antisense; AACTTTGACAGCAGGTGGTGCCGGT
>probe:Drosophila_2:1629847_at:442:625; Interrogation_Position=2289; Antisense; TGCCGGTGATTGGATGCAACTTCAT
>probe:Drosophila_2:1629847_at:656:217; Interrogation_Position=2334; Antisense; AAGTTTGTGTTTTTGCACTCGGCAA
>probe:Drosophila_2:1629847_at:722:171; Interrogation_Position=2396; Antisense; AAAGTTCTCAGCGATATTTCCAATA

Paste this into a BLAST search page for me
TTATGTCCCTGGTCGAAAGTTCCTTAGTTCCTTTTCAATCTACCCAAATGTACCCAAATGTGCACCCGAGTACTGGAGTACTGCACATCTCTGGATCAGTTGGATCAGTCGTGGTGCAGTACCCAAGCCACACAGTTGCAACCCGGAATAAATACGAGTCACAACTGTCGCGCTTTGTCGCGCTTTACTCAATTTGCAGTGAACGACATGAACGCTGACCAGGATGCTGGCCAGGGCAACTCAACTGATAAACTTTGACAGCAGGTGGTGCCGGTTGCCGGTGATTGGATGCAACTTCATAAGTTTGTGTTTTTGCACTCGGCAAAAAGTTCTCAGCGATATTTCCAATA

Full Affymetrix probeset data:

Annotations for 1629847_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime