FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629849_at:

>probe:Drosophila_2:1629849_at:427:681; Interrogation_Position=1001; Antisense; TATGACACCCTGACCGGATTGGTAT
>probe:Drosophila_2:1629849_at:383:37; Interrogation_Position=1086; Antisense; ATCATTGCATGCATTGCCCTTCGGT
>probe:Drosophila_2:1629849_at:204:71; Interrogation_Position=1122; Antisense; AGGCTGCATTGGGACACTACTTGGC
>probe:Drosophila_2:1629849_at:141:217; Interrogation_Position=1160; Antisense; AAGTTGGACTGTTGCACACTCTCAA
>probe:Drosophila_2:1629849_at:71:109; Interrogation_Position=1184; Antisense; AGCACTTTCGGGTGGAACTCTGCGA
>probe:Drosophila_2:1629849_at:174:393; Interrogation_Position=1222; Antisense; GAAATGAGGTTCGATCCCTAAGCCT
>probe:Drosophila_2:1629849_at:606:659; Interrogation_Position=1240; Antisense; TAAGCCTCTGTTCTTACTGCTCATA
>probe:Drosophila_2:1629849_at:96:667; Interrogation_Position=1254; Antisense; TACTGCTCATAATGGGACCTTCCTT
>probe:Drosophila_2:1629849_at:267:239; Interrogation_Position=724; Antisense; AATCTATGAACTACGTCCTTGCTCA
>probe:Drosophila_2:1629849_at:702:503; Interrogation_Position=738; Antisense; GTCCTTGCTCAACGCGCAGAAAATT
>probe:Drosophila_2:1629849_at:495:691; Interrogation_Position=868; Antisense; TTTGCTTTTGGCTGGCTTTGATACC
>probe:Drosophila_2:1629849_at:658:383; Interrogation_Position=938; Antisense; GAACATCGATTGCAGGCGGAGCTCC
>probe:Drosophila_2:1629849_at:593:529; Interrogation_Position=963; Antisense; GGGTTGACCTTCAGTCTAGCCATAA
>probe:Drosophila_2:1629849_at:290:659; Interrogation_Position=985; Antisense; TAACCACCAACTTAGCTATGACACC

Paste this into a BLAST search page for me
TATGACACCCTGACCGGATTGGTATATCATTGCATGCATTGCCCTTCGGTAGGCTGCATTGGGACACTACTTGGCAAGTTGGACTGTTGCACACTCTCAAAGCACTTTCGGGTGGAACTCTGCGAGAAATGAGGTTCGATCCCTAAGCCTTAAGCCTCTGTTCTTACTGCTCATATACTGCTCATAATGGGACCTTCCTTAATCTATGAACTACGTCCTTGCTCAGTCCTTGCTCAACGCGCAGAAAATTTTTGCTTTTGGCTGGCTTTGATACCGAACATCGATTGCAGGCGGAGCTCCGGGTTGACCTTCAGTCTAGCCATAATAACCACCAACTTAGCTATGACACC

Full Affymetrix probeset data:

Annotations for 1629849_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720