Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629851_at:

>probe:Drosophila_2:1629851_at:283:423; Interrogation_Position=4179; Antisense; GAGAACCATCTACAACAGTTACCTT
>probe:Drosophila_2:1629851_at:546:475; Interrogation_Position=4196; Antisense; GTTACCTTATGGTCACAATTCCGAG
>probe:Drosophila_2:1629851_at:232:195; Interrogation_Position=4287; Antisense; AACGATCATGGTTTTGTCATTCCTG
>probe:Drosophila_2:1629851_at:559:9; Interrogation_Position=4305; Antisense; ATTCCTGTTGAAGATACGGCACCAA
>probe:Drosophila_2:1629851_at:589:141; Interrogation_Position=4320; Antisense; ACGGCACCAAATTCTATATCTATGA
>probe:Drosophila_2:1629851_at:350:181; Interrogation_Position=4349; Antisense; AAAAACACCATCACTTGCCGGGTCA
>probe:Drosophila_2:1629851_at:313:551; Interrogation_Position=4439; Antisense; GGAGTTATGCACGACTTCATCAGCT
>probe:Drosophila_2:1629851_at:293:713; Interrogation_Position=4454; Antisense; TTCATCAGCTTCAGTGGCGTCTGCA
>probe:Drosophila_2:1629851_at:374:521; Interrogation_Position=4467; Antisense; GTGGCGTCTGCATCTTCAAATTCAT
>probe:Drosophila_2:1629851_at:299:309; Interrogation_Position=4501; Antisense; CCAGTGCTTCTGATAGTATGCTTGT
>probe:Drosophila_2:1629851_at:160:103; Interrogation_Position=4529; Antisense; AGACCAAGGCTTTCTACGATTTCGG
>probe:Drosophila_2:1629851_at:367:293; Interrogation_Position=4545; Antisense; CGATTTCGGTCCATAGACGATCCAA
>probe:Drosophila_2:1629851_at:168:225; Interrogation_Position=4604; Antisense; AAGGACTGCAGTTTTATCCCTTCGT
>probe:Drosophila_2:1629851_at:475:683; Interrogation_Position=4618; Antisense; TATCCCTTCGTCTTAAAAGTTGCAG

Paste this into a BLAST search page for me
GAGAACCATCTACAACAGTTACCTTGTTACCTTATGGTCACAATTCCGAGAACGATCATGGTTTTGTCATTCCTGATTCCTGTTGAAGATACGGCACCAAACGGCACCAAATTCTATATCTATGAAAAAACACCATCACTTGCCGGGTCAGGAGTTATGCACGACTTCATCAGCTTTCATCAGCTTCAGTGGCGTCTGCAGTGGCGTCTGCATCTTCAAATTCATCCAGTGCTTCTGATAGTATGCTTGTAGACCAAGGCTTTCTACGATTTCGGCGATTTCGGTCCATAGACGATCCAAAAGGACTGCAGTTTTATCCCTTCGTTATCCCTTCGTCTTAAAAGTTGCAG

Full Affymetrix probeset data:

Annotations for 1629851_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime