FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629852_at:

>probe:Drosophila_2:1629852_at:229:201; Interrogation_Position=1098; Antisense; AACGCCTCGATGTACGTTCTTCATG
>probe:Drosophila_2:1629852_at:347:601; Interrogation_Position=1108; Antisense; TGTACGTTCTTCATGGTCTAGGCAA
>probe:Drosophila_2:1629852_at:385:473; Interrogation_Position=1113; Antisense; GTTCTTCATGGTCTAGGCAATGCAT
>probe:Drosophila_2:1629852_at:289:535; Interrogation_Position=1122; Antisense; GGTCTAGGCAATGCATGGTCCTTGG
>probe:Drosophila_2:1629852_at:145:97; Interrogation_Position=1160; Antisense; AGATCGTTATCCAAAAACTATGGGA
>probe:Drosophila_2:1629852_at:722:145; Interrogation_Position=1176; Antisense; ACTATGGGATGTTGTTCGTCACTGC
>probe:Drosophila_2:1629852_at:507:59; Interrogation_Position=1184; Antisense; ATGTTGTTCGTCACTGCCTCTATTT
>probe:Drosophila_2:1629852_at:637:493; Interrogation_Position=1193; Antisense; GTCACTGCCTCTATTTTATGTTACC
>probe:Drosophila_2:1629852_at:19:313; Interrogation_Position=1199; Antisense; GCCTCTATTTTATGTTACCTAGTCT
>probe:Drosophila_2:1629852_at:647:641; Interrogation_Position=1213; Antisense; TTACCTAGTCTAGTCGTTTGTCGGC
>probe:Drosophila_2:1629852_at:143:87; Interrogation_Position=1219; Antisense; AGTCTAGTCGTTTGTCGGCTATCCA
>probe:Drosophila_2:1629852_at:108:481; Interrogation_Position=1228; Antisense; GTTTGTCGGCTATCCACATTTTGTA
>probe:Drosophila_2:1629852_at:68:501; Interrogation_Position=1232; Antisense; GTCGGCTATCCACATTTTGTATTAA
>probe:Drosophila_2:1629852_at:349:209; Interrogation_Position=1278; Antisense; AAGAAACCGAAGCTAATCTAATGCA

Paste this into a BLAST search page for me
AACGCCTCGATGTACGTTCTTCATGTGTACGTTCTTCATGGTCTAGGCAAGTTCTTCATGGTCTAGGCAATGCATGGTCTAGGCAATGCATGGTCCTTGGAGATCGTTATCCAAAAACTATGGGAACTATGGGATGTTGTTCGTCACTGCATGTTGTTCGTCACTGCCTCTATTTGTCACTGCCTCTATTTTATGTTACCGCCTCTATTTTATGTTACCTAGTCTTTACCTAGTCTAGTCGTTTGTCGGCAGTCTAGTCGTTTGTCGGCTATCCAGTTTGTCGGCTATCCACATTTTGTAGTCGGCTATCCACATTTTGTATTAAAAGAAACCGAAGCTAATCTAATGCA

Full Affymetrix probeset data:

Annotations for 1629852_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720