Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629853_at:

>probe:Drosophila_2:1629853_at:186:223; Interrogation_Position=283; Antisense; AAGGGTGGCCTCATCGATCTGGACA
>probe:Drosophila_2:1629853_at:563:293; Interrogation_Position=309; Antisense; CGAGGAATTCGACGCGGTGCTCAAT
>probe:Drosophila_2:1629853_at:252:331; Interrogation_Position=322; Antisense; GCGGTGCTCAATACCAATCTGCGTG
>probe:Drosophila_2:1629853_at:646:237; Interrogation_Position=337; Antisense; AATCTGCGTGGTGTCATTCTGTTGA
>probe:Drosophila_2:1629853_at:581:11; Interrogation_Position=352; Antisense; ATTCTGTTGACCAAGGCGGTGCTCC
>probe:Drosophila_2:1629853_at:589:275; Interrogation_Position=438; Antisense; CTTCGCCGGAGCACTGAGCTATGGA
>probe:Drosophila_2:1629853_at:227:115; Interrogation_Position=454; Antisense; AGCTATGGAGTTTCGAAGGCCGCCC
>probe:Drosophila_2:1629853_at:478:93; Interrogation_Position=485; Antisense; AGTTCACCAAGATTGTGGCCCTCGA
>probe:Drosophila_2:1629853_at:413:717; Interrogation_Position=553; Antisense; TTCGTGGTGACCAACATCCATCGGA
>probe:Drosophila_2:1629853_at:71:49; Interrogation_Position=568; Antisense; ATCCATCGGAACATTGGCATCGTCG
>probe:Drosophila_2:1629853_at:540:87; Interrogation_Position=599; Antisense; AGTACAACGGAATGCTCCAGCGGGC
>probe:Drosophila_2:1629853_at:320:247; Interrogation_Position=628; Antisense; AATTCGCATCCCATGGGCCGTGTAG
>probe:Drosophila_2:1629853_at:242:699; Interrogation_Position=685; Antisense; TTTTTGGCCAGCTCCAAGGCAAGTT
>probe:Drosophila_2:1629853_at:540:209; Interrogation_Position=745; Antisense; AAGCACAATCTGACGCCTCGTTAAG

Paste this into a BLAST search page for me
AAGGGTGGCCTCATCGATCTGGACACGAGGAATTCGACGCGGTGCTCAATGCGGTGCTCAATACCAATCTGCGTGAATCTGCGTGGTGTCATTCTGTTGAATTCTGTTGACCAAGGCGGTGCTCCCTTCGCCGGAGCACTGAGCTATGGAAGCTATGGAGTTTCGAAGGCCGCCCAGTTCACCAAGATTGTGGCCCTCGATTCGTGGTGACCAACATCCATCGGAATCCATCGGAACATTGGCATCGTCGAGTACAACGGAATGCTCCAGCGGGCAATTCGCATCCCATGGGCCGTGTAGTTTTTGGCCAGCTCCAAGGCAAGTTAAGCACAATCTGACGCCTCGTTAAG

Full Affymetrix probeset data:

Annotations for 1629853_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime