FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629854_at:

>probe:Drosophila_2:1629854_at:420:729; Interrogation_Position=1097; Antisense; TTGGCGAGAATGTCAGCCTGCTGAC
>probe:Drosophila_2:1629854_at:167:301; Interrogation_Position=1173; Antisense; CGCCTATTTGCACACGTCGAAGATC
>probe:Drosophila_2:1629854_at:601:51; Interrogation_Position=1223; Antisense; ATGCTATTCTGCACGCATTGGGCGG
>probe:Drosophila_2:1629854_at:400:5; Interrogation_Position=1239; Antisense; ATTGGGCGGCACAATGACCACGCTG
>probe:Drosophila_2:1629854_at:642:133; Interrogation_Position=1280; Antisense; ACTACGGACCAGAGGAATCGCCAGT
>probe:Drosophila_2:1629854_at:452:45; Interrogation_Position=1296; Antisense; ATCGCCAGTCAATACGGAGGGCCTG
>probe:Drosophila_2:1629854_at:380:579; Interrogation_Position=1323; Antisense; GGCCACCTTGGAGCAGCATGACGAG
>probe:Drosophila_2:1629854_at:642:159; Interrogation_Position=1355; Antisense; ACAAGCTGTCCAAATATCGCGAGGC
>probe:Drosophila_2:1629854_at:358:45; Interrogation_Position=1370; Antisense; ATCGCGAGGCGCACAATGGCAAGCT
>probe:Drosophila_2:1629854_at:460:301; Interrogation_Position=1452; Antisense; CCCACATCGTTTAGGCAGCATTCAA
>probe:Drosophila_2:1629854_at:261:173; Interrogation_Position=1501; Antisense; AAACCTGTTTTTCGTAATCTCAATG
>probe:Drosophila_2:1629854_at:139:251; Interrogation_Position=1521; Antisense; CAATGTTTGTTTGTGCGTGTGCTTC
>probe:Drosophila_2:1629854_at:162:31; Interrogation_Position=1557; Antisense; ATAATTACGTTGGTTGTGCGGCGGC
>probe:Drosophila_2:1629854_at:540:255; Interrogation_Position=1610; Antisense; CAAACCGCCCAGTTGGCTCAAAATA

Paste this into a BLAST search page for me
TTGGCGAGAATGTCAGCCTGCTGACCGCCTATTTGCACACGTCGAAGATCATGCTATTCTGCACGCATTGGGCGGATTGGGCGGCACAATGACCACGCTGACTACGGACCAGAGGAATCGCCAGTATCGCCAGTCAATACGGAGGGCCTGGGCCACCTTGGAGCAGCATGACGAGACAAGCTGTCCAAATATCGCGAGGCATCGCGAGGCGCACAATGGCAAGCTCCCACATCGTTTAGGCAGCATTCAAAAACCTGTTTTTCGTAATCTCAATGCAATGTTTGTTTGTGCGTGTGCTTCATAATTACGTTGGTTGTGCGGCGGCCAAACCGCCCAGTTGGCTCAAAATA

Full Affymetrix probeset data:

Annotations for 1629854_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720