Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629858_at:

>probe:Drosophila_2:1629858_at:471:709; Interrogation_Position=1553; Antisense; TTAACTACAGCCTAATGCCATCCTT
>probe:Drosophila_2:1629858_at:515:47; Interrogation_Position=1572; Antisense; ATCCTTCGGCATACTGAGTCTGATG
>probe:Drosophila_2:1629858_at:456:711; Interrogation_Position=1706; Antisense; TTAATGATTTTCAAGCCGCCGCTGA
>probe:Drosophila_2:1629858_at:404:303; Interrogation_Position=1721; Antisense; CCGCCGCTGAGTTTTTGACCAAGAA
>probe:Drosophila_2:1629858_at:179:465; Interrogation_Position=1766; Antisense; GATTGGCTATACAGGGCGCCTCGAA
>probe:Drosophila_2:1629858_at:130:315; Interrogation_Position=1781; Antisense; GCGCCTCGAATGGTGGACTTTTGGT
>probe:Drosophila_2:1629858_at:389:403; Interrogation_Position=1796; Antisense; GACTTTTGGTGGGTGCTTGCATCAA
>probe:Drosophila_2:1629858_at:488:239; Interrogation_Position=1819; Antisense; AATCAGCGTCCTGATCTTTTCGGAG
>probe:Drosophila_2:1629858_at:294:697; Interrogation_Position=1891; Antisense; TTTACTATCGGTCATGCCTGGTGTT
>probe:Drosophila_2:1629858_at:374:513; Interrogation_Position=1911; Antisense; GTGTTCCGATTATGGCAATCCCGAT
>probe:Drosophila_2:1629858_at:606:645; Interrogation_Position=1974; Antisense; TCTTCACAACGTTCATATTCCTCTG
>probe:Drosophila_2:1629858_at:700:645; Interrogation_Position=2007; Antisense; TCAGGAGTACCCATCGACATTAATT
>probe:Drosophila_2:1629858_at:648:515; Interrogation_Position=2054; Antisense; GTGTAAGTCCTTTGCACTCCTATAA
>probe:Drosophila_2:1629858_at:534:145; Interrogation_Position=2069; Antisense; ACTCCTATAAATTTGTTGCTGCCCT

Paste this into a BLAST search page for me
TTAACTACAGCCTAATGCCATCCTTATCCTTCGGCATACTGAGTCTGATGTTAATGATTTTCAAGCCGCCGCTGACCGCCGCTGAGTTTTTGACCAAGAAGATTGGCTATACAGGGCGCCTCGAAGCGCCTCGAATGGTGGACTTTTGGTGACTTTTGGTGGGTGCTTGCATCAAAATCAGCGTCCTGATCTTTTCGGAGTTTACTATCGGTCATGCCTGGTGTTGTGTTCCGATTATGGCAATCCCGATTCTTCACAACGTTCATATTCCTCTGTCAGGAGTACCCATCGACATTAATTGTGTAAGTCCTTTGCACTCCTATAAACTCCTATAAATTTGTTGCTGCCCT

Full Affymetrix probeset data:

Annotations for 1629858_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime