FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629860_at:

>probe:Drosophila_2:1629860_at:183:599; Interrogation_Position=376; Antisense; TGTCTGACCGATGCCATAGCTGCAA
>probe:Drosophila_2:1629860_at:437:357; Interrogation_Position=397; Antisense; GCAAAGATATACACGGGCGCCACCG
>probe:Drosophila_2:1629860_at:410:311; Interrogation_Position=415; Antisense; GCCACCGTATTTGCCGATGTAGAAG
>probe:Drosophila_2:1629860_at:641:85; Interrogation_Position=514; Antisense; AGTGACTTGGCTTTAATACGACTGC
>probe:Drosophila_2:1629860_at:357:567; Interrogation_Position=616; Antisense; GGCAAAGTGGTGACCCTATCTGGCT
>probe:Drosophila_2:1629860_at:42:469; Interrogation_Position=644; Antisense; GTTACTTGGGAGATTCAACCGACAA
>probe:Drosophila_2:1629860_at:456:405; Interrogation_Position=677; Antisense; GACTCCTCCAGTACTTAGATGCGGA
>probe:Drosophila_2:1629860_at:621:35; Interrogation_Position=710; Antisense; ATCAGGAACGCTGCATCTGCTATTT
>probe:Drosophila_2:1629860_at:49:719; Interrogation_Position=733; Antisense; TTCCTGCCAGGATTGGTTAGCCAGC
>probe:Drosophila_2:1629860_at:248:407; Interrogation_Position=758; Antisense; GACGTCACCTGTGCACCGATGGAAG
>probe:Drosophila_2:1629860_at:361:209; Interrogation_Position=780; Antisense; AAGCAATGGACGTGGTGCCTGCAAT
>probe:Drosophila_2:1629860_at:526:287; Interrogation_Position=834; Antisense; CTGGCGCAATGTTAGCTACCTGATT
>probe:Drosophila_2:1629860_at:25:499; Interrogation_Position=910; Antisense; GTCTACACCAGGATAACCGCATATT
>probe:Drosophila_2:1629860_at:3:201; Interrogation_Position=924; Antisense; AACCGCATATTTGCCATGGATCCGA

Paste this into a BLAST search page for me
TGTCTGACCGATGCCATAGCTGCAAGCAAAGATATACACGGGCGCCACCGGCCACCGTATTTGCCGATGTAGAAGAGTGACTTGGCTTTAATACGACTGCGGCAAAGTGGTGACCCTATCTGGCTGTTACTTGGGAGATTCAACCGACAAGACTCCTCCAGTACTTAGATGCGGAATCAGGAACGCTGCATCTGCTATTTTTCCTGCCAGGATTGGTTAGCCAGCGACGTCACCTGTGCACCGATGGAAGAAGCAATGGACGTGGTGCCTGCAATCTGGCGCAATGTTAGCTACCTGATTGTCTACACCAGGATAACCGCATATTAACCGCATATTTGCCATGGATCCGA

Full Affymetrix probeset data:

Annotations for 1629860_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720