FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629862_at:

>probe:Drosophila_2:1629862_at:348:381; Interrogation_Position=267; Antisense; GAACCCAACTTACTTTGGCTATCAT
>probe:Drosophila_2:1629862_at:570:571; Interrogation_Position=283; Antisense; GGCTATCATCGATTCTCATTTATGG
>probe:Drosophila_2:1629862_at:155:3; Interrogation_Position=300; Antisense; ATTTATGGAACTCACGGTCACGGCT
>probe:Drosophila_2:1629862_at:304:257; Interrogation_Position=312; Antisense; CACGGTCACGGCTGTGGAGTTACGA
>probe:Drosophila_2:1629862_at:610:407; Interrogation_Position=352; Antisense; GACGGAGGACTACAGGCATCCATCG
>probe:Drosophila_2:1629862_at:123:347; Interrogation_Position=367; Antisense; GCATCCATCGAAGCCGACGAAGAAT
>probe:Drosophila_2:1629862_at:97:211; Interrogation_Position=386; Antisense; AAGAATCCGAGTGTGGCGAGGCCCA
>probe:Drosophila_2:1629862_at:381:327; Interrogation_Position=401; Antisense; GCGAGGCCCAACTGGAGACCATGAA
>probe:Drosophila_2:1629862_at:653:205; Interrogation_Position=435; Antisense; AAGCGAGTGCGATGCGATACTCTCC
>probe:Drosophila_2:1629862_at:95:457; Interrogation_Position=450; Antisense; GATACTCTCCAACCAAGCCAAGAAA
>probe:Drosophila_2:1629862_at:186:105; Interrogation_Position=479; Antisense; AGAAGGCCAAATCTTCGGCCGAGGA
>probe:Drosophila_2:1629862_at:359:37; Interrogation_Position=489; Antisense; ATCTTCGGCCGAGGAGAAGTGTCTC
>probe:Drosophila_2:1629862_at:605:561; Interrogation_Position=645; Antisense; GGAACTGAAGGCTTGGTGCCAGAAA
>probe:Drosophila_2:1629862_at:708:439; Interrogation_Position=757; Antisense; GATGAACTGAAAGCTTGGTGCCAAA

Paste this into a BLAST search page for me
GAACCCAACTTACTTTGGCTATCATGGCTATCATCGATTCTCATTTATGGATTTATGGAACTCACGGTCACGGCTCACGGTCACGGCTGTGGAGTTACGAGACGGAGGACTACAGGCATCCATCGGCATCCATCGAAGCCGACGAAGAATAAGAATCCGAGTGTGGCGAGGCCCAGCGAGGCCCAACTGGAGACCATGAAAAGCGAGTGCGATGCGATACTCTCCGATACTCTCCAACCAAGCCAAGAAAAGAAGGCCAAATCTTCGGCCGAGGAATCTTCGGCCGAGGAGAAGTGTCTCGGAACTGAAGGCTTGGTGCCAGAAAGATGAACTGAAAGCTTGGTGCCAAA

Full Affymetrix probeset data:

Annotations for 1629862_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720