FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629863_at:

>probe:Drosophila_2:1629863_at:595:551; Interrogation_Position=6214; Antisense; GGAGCACTCCGTTCGTACTGAAGTA
>probe:Drosophila_2:1629863_at:375:373; Interrogation_Position=6233; Antisense; GAAGTACAATGCCTGTCAGCCCGTT
>probe:Drosophila_2:1629863_at:362:245; Interrogation_Position=6270; Antisense; AATTACGAAACCTCGCTGTTCTCAC
>probe:Drosophila_2:1629863_at:527:641; Interrogation_Position=6315; Antisense; TCTGGTGTGGAGTTCCTGAGCAGCC
>probe:Drosophila_2:1629863_at:699:5; Interrogation_Position=6364; Antisense; ATTCCTTTCAGCACGGAGGCTCTAA
>probe:Drosophila_2:1629863_at:45:123; Interrogation_Position=6388; Antisense; AGCGCGGCAACAACACGGAAGTTTT
>probe:Drosophila_2:1629863_at:471:91; Interrogation_Position=6407; Antisense; AGTTTTATGCCCCAGACATGCGAAG
>probe:Drosophila_2:1629863_at:687:47; Interrogation_Position=6424; Antisense; ATGCGAAGGCCCACTTGGAGCTGCG
>probe:Drosophila_2:1629863_at:470:241; Interrogation_Position=6456; Antisense; AATACGGACAGCAGTGACACCTATG
>probe:Drosophila_2:1629863_at:355:57; Interrogation_Position=6478; Antisense; ATGAGGACTCTCTGAAGACGGACGA
>probe:Drosophila_2:1629863_at:275:577; Interrogation_Position=6512; Antisense; GGCGCATAACTGTCGCAGTGCCAAT
>probe:Drosophila_2:1629863_at:82:387; Interrogation_Position=6587; Antisense; GAACACGCGGTTCGAGAAGCGCTCC
>probe:Drosophila_2:1629863_at:195:53; Interrogation_Position=6651; Antisense; ATGCAGCAGTCACCGCAGATTTCAC
>probe:Drosophila_2:1629863_at:171:283; Interrogation_Position=6696; Antisense; CTCCGCAACTCGATGAATGACCTGG

Paste this into a BLAST search page for me
GGAGCACTCCGTTCGTACTGAAGTAGAAGTACAATGCCTGTCAGCCCGTTAATTACGAAACCTCGCTGTTCTCACTCTGGTGTGGAGTTCCTGAGCAGCCATTCCTTTCAGCACGGAGGCTCTAAAGCGCGGCAACAACACGGAAGTTTTAGTTTTATGCCCCAGACATGCGAAGATGCGAAGGCCCACTTGGAGCTGCGAATACGGACAGCAGTGACACCTATGATGAGGACTCTCTGAAGACGGACGAGGCGCATAACTGTCGCAGTGCCAATGAACACGCGGTTCGAGAAGCGCTCCATGCAGCAGTCACCGCAGATTTCACCTCCGCAACTCGATGAATGACCTGG

Full Affymetrix probeset data:

Annotations for 1629863_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720