Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629864_at:

>probe:Drosophila_2:1629864_at:684:247; Interrogation_Position=1409; Antisense; CAATTCCTAATCTTGGGCCACCTGG
>probe:Drosophila_2:1629864_at:620:521; Interrogation_Position=1423; Antisense; GGGCCACCTGGCATAATGTACCGAC
>probe:Drosophila_2:1629864_at:250:531; Interrogation_Position=1473; Antisense; GGGTTCCGGCTTTGGCATACGCATG
>probe:Drosophila_2:1629864_at:383:241; Interrogation_Position=1545; Antisense; AATACCGCGCATGGGCATCAGGATG
>probe:Drosophila_2:1629864_at:660:313; Interrogation_Position=1601; Antisense; GCCTTGCGCACCACAATAAGCAGGG
>probe:Drosophila_2:1629864_at:563:349; Interrogation_Position=1633; Antisense; GCAGGTGCACCAAAGGAGTCAGCCA
>probe:Drosophila_2:1629864_at:584:531; Interrogation_Position=1659; Antisense; GGGTGTGGCCACTATTACAGCCAAG
>probe:Drosophila_2:1629864_at:241:73; Interrogation_Position=1693; Antisense; AGGAATCTGAGTGCGGATGTCACCC
>probe:Drosophila_2:1629864_at:412:725; Interrogation_Position=1721; Antisense; TTGTACCGTCCACGTTGCGAGTGAA
>probe:Drosophila_2:1629864_at:26:269; Interrogation_Position=1776; Antisense; CAGGCATGCGGCCAACGATGGACAC
>probe:Drosophila_2:1629864_at:718:249; Interrogation_Position=1836; Antisense; CAAGGATGACGCCTATCTGCAGTTC
>probe:Drosophila_2:1629864_at:221:53; Interrogation_Position=1870; Antisense; ATGCAGGGCTTGCTGTAGCACGCAA
>probe:Drosophila_2:1629864_at:711:485; Interrogation_Position=1911; Antisense; GTAGCTGAGTAGTCTAAGTCCTAGA
>probe:Drosophila_2:1629864_at:672:139; Interrogation_Position=1940; Antisense; ACGTGTCATCCAAACCAATACCAAA

Paste this into a BLAST search page for me
CAATTCCTAATCTTGGGCCACCTGGGGGCCACCTGGCATAATGTACCGACGGGTTCCGGCTTTGGCATACGCATGAATACCGCGCATGGGCATCAGGATGGCCTTGCGCACCACAATAAGCAGGGGCAGGTGCACCAAAGGAGTCAGCCAGGGTGTGGCCACTATTACAGCCAAGAGGAATCTGAGTGCGGATGTCACCCTTGTACCGTCCACGTTGCGAGTGAACAGGCATGCGGCCAACGATGGACACCAAGGATGACGCCTATCTGCAGTTCATGCAGGGCTTGCTGTAGCACGCAAGTAGCTGAGTAGTCTAAGTCCTAGAACGTGTCATCCAAACCAATACCAAA

Full Affymetrix probeset data:

Annotations for 1629864_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime