Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629865_s_at:

>probe:Drosophila_2:1629865_s_at:728:477; Interrogation_Position=101; Antisense; GTTTCGGCGACTTGGCCACAGAAAA
>probe:Drosophila_2:1629865_s_at:442:155; Interrogation_Position=118; Antisense; ACAGAAAAGGATCGCGCCGTCGTCA
>probe:Drosophila_2:1629865_s_at:125:653; Interrogation_Position=152; Antisense; TCAATCTGCTGACAAACATCTCCGG
>probe:Drosophila_2:1629865_s_at:610:249; Interrogation_Position=210; Antisense; CAATGCCGAGTTGGAGTCGCACAAG
>probe:Drosophila_2:1629865_s_at:673:507; Interrogation_Position=300; Antisense; GTGCTGCTCGCAGTGCTTCGAAAAG
>probe:Drosophila_2:1629865_s_at:345:173; Interrogation_Position=321; Antisense; AAAGCGCAATGTTCGGAGTCTGGAC
>probe:Drosophila_2:1629865_s_at:504:507; Interrogation_Position=346; Antisense; GTGCTACTCCGCTACCTAAGGCAAT
>probe:Drosophila_2:1629865_s_at:171:657; Interrogation_Position=362; Antisense; TAAGGCAATCTCTGGCCCAACAGGA
>probe:Drosophila_2:1629865_s_at:428:439; Interrogation_Position=391; Antisense; GAGGCTAGCTCGCATGAGTTGCTTT
>probe:Drosophila_2:1629865_s_at:487:57; Interrogation_Position=404; Antisense; ATGAGTTGCTTTCCCCAGTGCTGAC
>probe:Drosophila_2:1629865_s_at:392:267; Interrogation_Position=419; Antisense; CAGTGCTGACCGTGCTGGTGAAATG
>probe:Drosophila_2:1629865_s_at:565:229; Interrogation_Position=440; Antisense; AATGTGCGCGCAGCGATCGAGTTAT
>probe:Drosophila_2:1629865_s_at:586:683; Interrogation_Position=462; Antisense; TATGCGTCACTATCTACGCCAGGAG
>probe:Drosophila_2:1629865_s_at:205:335; Interrogation_Position=498; Antisense; GCTGCGGGACGTTAGTCAACGACCT

Paste this into a BLAST search page for me
GTTTCGGCGACTTGGCCACAGAAAAACAGAAAAGGATCGCGCCGTCGTCATCAATCTGCTGACAAACATCTCCGGCAATGCCGAGTTGGAGTCGCACAAGGTGCTGCTCGCAGTGCTTCGAAAAGAAAGCGCAATGTTCGGAGTCTGGACGTGCTACTCCGCTACCTAAGGCAATTAAGGCAATCTCTGGCCCAACAGGAGAGGCTAGCTCGCATGAGTTGCTTTATGAGTTGCTTTCCCCAGTGCTGACCAGTGCTGACCGTGCTGGTGAAATGAATGTGCGCGCAGCGATCGAGTTATTATGCGTCACTATCTACGCCAGGAGGCTGCGGGACGTTAGTCAACGACCT

Full Affymetrix probeset data:

Annotations for 1629865_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime