FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629866_at:

>probe:Drosophila_2:1629866_at:695:471; Interrogation_Position=5580; Antisense; GTTAATTACTACAAAGCGAGCTGGT
>probe:Drosophila_2:1629866_at:39:553; Interrogation_Position=5625; Antisense; GGAGCTTACACTTTCACATACATAT
>probe:Drosophila_2:1629866_at:228:183; Interrogation_Position=5731; Antisense; AAAACGCTAAATACAACTCGATACA
>probe:Drosophila_2:1629866_at:630:253; Interrogation_Position=5744; Antisense; CAACTCGATACAAGTGGTGGTTCAA
>probe:Drosophila_2:1629866_at:30:517; Interrogation_Position=5760; Antisense; GTGGTTCAAGTGGTTCGACGGACCA
>probe:Drosophila_2:1629866_at:402:471; Interrogation_Position=5772; Antisense; GTTCGACGGACCATGCAATCTGGTT
>probe:Drosophila_2:1629866_at:721:615; Interrogation_Position=5785; Antisense; TGCAATCTGGTTTAATTCACATGAA
>probe:Drosophila_2:1629866_at:417:641; Interrogation_Position=5810; Antisense; TCTGAATCCAAAACAACTCGCACTC
>probe:Drosophila_2:1629866_at:387:625; Interrogation_Position=5837; Antisense; TGCCCTTCGTTTTATTGCCAGCTTA
>probe:Drosophila_2:1629866_at:305:9; Interrogation_Position=5850; Antisense; ATTGCCAGCTTATTGTTTATTTTGT
>probe:Drosophila_2:1629866_at:492:725; Interrogation_Position=5871; Antisense; TTGTTCTCTGTGAAATTTGGTTTTT
>probe:Drosophila_2:1629866_at:402:191; Interrogation_Position=5914; Antisense; AACTACAACTAAACCATCACAACCA
>probe:Drosophila_2:1629866_at:126:483; Interrogation_Position=6084; Antisense; GTATTATTTTCTAAGCTGCCGCGGC
>probe:Drosophila_2:1629866_at:536:303; Interrogation_Position=6102; Antisense; CCGCGGCCGCAAAACATTCATAATA

Paste this into a BLAST search page for me
GTTAATTACTACAAAGCGAGCTGGTGGAGCTTACACTTTCACATACATATAAAACGCTAAATACAACTCGATACACAACTCGATACAAGTGGTGGTTCAAGTGGTTCAAGTGGTTCGACGGACCAGTTCGACGGACCATGCAATCTGGTTTGCAATCTGGTTTAATTCACATGAATCTGAATCCAAAACAACTCGCACTCTGCCCTTCGTTTTATTGCCAGCTTAATTGCCAGCTTATTGTTTATTTTGTTTGTTCTCTGTGAAATTTGGTTTTTAACTACAACTAAACCATCACAACCAGTATTATTTTCTAAGCTGCCGCGGCCCGCGGCCGCAAAACATTCATAATA

Full Affymetrix probeset data:

Annotations for 1629866_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720