Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629867_a_at:

>probe:Drosophila_2:1629867_a_at:183:537; Interrogation_Position=136; Antisense; GGTCTGATCCGCAAGTATGGCCTTA
>probe:Drosophila_2:1629867_a_at:19:219; Interrogation_Position=148; Antisense; AAGTATGGCCTTAACATCTGCCGCC
>probe:Drosophila_2:1629867_a_at:319:39; Interrogation_Position=163; Antisense; ATCTGCCGCCAGTGCTTCAGGGAGT
>probe:Drosophila_2:1629867_a_at:204:333; Interrogation_Position=176; Antisense; GCTTCAGGGAGTACGCCAACGACAT
>probe:Drosophila_2:1629867_a_at:397:403; Interrogation_Position=217; Antisense; GACTAAATGTGTCCTCTTCGCATTT
>probe:Drosophila_2:1629867_a_at:99:273; Interrogation_Position=232; Antisense; CTTCGCATTTTAACGCGGTAATCGC
>probe:Drosophila_2:1629867_a_at:190:331; Interrogation_Position=246; Antisense; GCGGTAATCGCGTATATTAATGCAT
>probe:Drosophila_2:1629867_a_at:307:707; Interrogation_Position=272; Antisense; TTAATGTATGGAGTCGTCGGATGTC
>probe:Drosophila_2:1629867_a_at:553:489; Interrogation_Position=306; Antisense; GTAAATTAGTATGCCGGCAGCAACA
>probe:Drosophila_2:1629867_a_at:712:205; Interrogation_Position=369; Antisense; AAGCGCATCGAAGCATTGATTCAAT
>probe:Drosophila_2:1629867_a_at:498:253; Interrogation_Position=422; Antisense; CAAAATGCCAACAGTTACCACCTTC
>probe:Drosophila_2:1629867_a_at:186:675; Interrogation_Position=444; Antisense; TTCCGCGAAGGATCTTTGTTAAAGC
>probe:Drosophila_2:1629867_a_at:328:677; Interrogation_Position=471; Antisense; TAGTTTTGTTTAAATCTCCGCCTGA
>probe:Drosophila_2:1629867_a_at:147:237; Interrogation_Position=483; Antisense; AATCTCCGCCTGATTAAACCCATAA

Paste this into a BLAST search page for me
GGTCTGATCCGCAAGTATGGCCTTAAAGTATGGCCTTAACATCTGCCGCCATCTGCCGCCAGTGCTTCAGGGAGTGCTTCAGGGAGTACGCCAACGACATGACTAAATGTGTCCTCTTCGCATTTCTTCGCATTTTAACGCGGTAATCGCGCGGTAATCGCGTATATTAATGCATTTAATGTATGGAGTCGTCGGATGTCGTAAATTAGTATGCCGGCAGCAACAAAGCGCATCGAAGCATTGATTCAATCAAAATGCCAACAGTTACCACCTTCTTCCGCGAAGGATCTTTGTTAAAGCTAGTTTTGTTTAAATCTCCGCCTGAAATCTCCGCCTGATTAAACCCATAA

Full Affymetrix probeset data:

Annotations for 1629867_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime