FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629870_at:

>probe:Drosophila_2:1629870_at:276:279; Interrogation_Position=159; Antisense; CTACCACATCAATTTGCCGCTATAT
>probe:Drosophila_2:1629870_at:298:689; Interrogation_Position=183; Antisense; TATTTTGGACATGGTGCGCATCTTC
>probe:Drosophila_2:1629870_at:13:345; Interrogation_Position=200; Antisense; GCATCTTCCAGGATCATCCCAAGTA
>probe:Drosophila_2:1629870_at:81:591; Interrogation_Position=231; Antisense; TGGTATCCACGAGGAGCACATTCTG
>probe:Drosophila_2:1629870_at:664:169; Interrogation_Position=267; Antisense; AAAGGAACCCTTTGCCTGTGGCGAT
>probe:Drosophila_2:1629870_at:692:587; Interrogation_Position=293; Antisense; TGGAGTCGCAGGTGAAGACCGCTCT
>probe:Drosophila_2:1629870_at:231:637; Interrogation_Position=315; Antisense; TCTGCTGGACCTAACGGCCAAGGGA
>probe:Drosophila_2:1629870_at:558:529; Interrogation_Position=336; Antisense; GGGATTCATACGCTTCATTACCAAT
>probe:Drosophila_2:1629870_at:159:651; Interrogation_Position=419; Antisense; TCAACATGACATGGCAGCGCATTGC
>probe:Drosophila_2:1629870_at:600:371; Interrogation_Position=453; Antisense; GAAGGTCAACTGTCCGAGCCTGGAG
>probe:Drosophila_2:1629870_at:449:439; Interrogation_Position=475; Antisense; GAGGCGGGATCCATCTCCAGCGGAC
>probe:Drosophila_2:1629870_at:724:121; Interrogation_Position=509; Antisense; AGCGCGGAGCCAACTACTAAATGAT
>probe:Drosophila_2:1629870_at:420:429; Interrogation_Position=568; Antisense; GAGTTCATTTCCTTGCAGATCAGCA
>probe:Drosophila_2:1629870_at:324:97; Interrogation_Position=584; Antisense; AGATCAGCAGAGTAACGCGCCACAC

Paste this into a BLAST search page for me
CTACCACATCAATTTGCCGCTATATTATTTTGGACATGGTGCGCATCTTCGCATCTTCCAGGATCATCCCAAGTATGGTATCCACGAGGAGCACATTCTGAAAGGAACCCTTTGCCTGTGGCGATTGGAGTCGCAGGTGAAGACCGCTCTTCTGCTGGACCTAACGGCCAAGGGAGGGATTCATACGCTTCATTACCAATTCAACATGACATGGCAGCGCATTGCGAAGGTCAACTGTCCGAGCCTGGAGGAGGCGGGATCCATCTCCAGCGGACAGCGCGGAGCCAACTACTAAATGATGAGTTCATTTCCTTGCAGATCAGCAAGATCAGCAGAGTAACGCGCCACAC

Full Affymetrix probeset data:

Annotations for 1629870_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720