Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629871_at:

>probe:Drosophila_2:1629871_at:718:401; Interrogation_Position=2037; Antisense; GACATCATCGTATGGCATCAGCCTT
>probe:Drosophila_2:1629871_at:624:67; Interrogation_Position=2048; Antisense; ATGGCATCAGCCTTTTCGTTAATGG
>probe:Drosophila_2:1629871_at:320:305; Interrogation_Position=2058; Antisense; CCTTTTCGTTAATGGCTTGTTGCAG
>probe:Drosophila_2:1629871_at:195:273; Interrogation_Position=2073; Antisense; CTTGTTGCAGTTGGTTGGGCCGCCA
>probe:Drosophila_2:1629871_at:46:729; Interrogation_Position=2087; Antisense; TTGGGCCGCCATTATGTAACTACTG
>probe:Drosophila_2:1629871_at:728:491; Interrogation_Position=2102; Antisense; GTAACTACTGGTTCGAGGCGGTCAA
>probe:Drosophila_2:1629871_at:413:59; Interrogation_Position=2126; Antisense; ATGATTATAATCCTCTCTTCCACGC
>probe:Drosophila_2:1629871_at:111:333; Interrogation_Position=2170; Antisense; GCTGGAGCTAGCCTTTGGAGTTTTA
>probe:Drosophila_2:1629871_at:621:697; Interrogation_Position=2190; Antisense; TTTTATGCCATGGATTAACCGACGC
>probe:Drosophila_2:1629871_at:723:173; Interrogation_Position=2254; Antisense; AAAGCGGCTGTCGATAGCTACTAAA
>probe:Drosophila_2:1629871_at:210:495; Interrogation_Position=2281; Antisense; GTCAAACAACTCTCGTACCAAACCA
>probe:Drosophila_2:1629871_at:256:113; Interrogation_Position=2362; Antisense; AGCAGCCAGGACTAAAAGACCATTA
>probe:Drosophila_2:1629871_at:130:493; Interrogation_Position=2396; Antisense; GTAACCTTTGATTCGTTTCTTCCAG
>probe:Drosophila_2:1629871_at:342:463; Interrogation_Position=2405; Antisense; GATTCGTTTCTTCCAGCTGATTTAT

Paste this into a BLAST search page for me
GACATCATCGTATGGCATCAGCCTTATGGCATCAGCCTTTTCGTTAATGGCCTTTTCGTTAATGGCTTGTTGCAGCTTGTTGCAGTTGGTTGGGCCGCCATTGGGCCGCCATTATGTAACTACTGGTAACTACTGGTTCGAGGCGGTCAAATGATTATAATCCTCTCTTCCACGCGCTGGAGCTAGCCTTTGGAGTTTTATTTTATGCCATGGATTAACCGACGCAAAGCGGCTGTCGATAGCTACTAAAGTCAAACAACTCTCGTACCAAACCAAGCAGCCAGGACTAAAAGACCATTAGTAACCTTTGATTCGTTTCTTCCAGGATTCGTTTCTTCCAGCTGATTTAT

Full Affymetrix probeset data:

Annotations for 1629871_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime