FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629874_at:

>probe:Drosophila_2:1629874_at:75:79; Interrogation_Position=1315; Antisense; AGGTCGAAATTGTAAGGCATCCTTT
>probe:Drosophila_2:1629874_at:649:373; Interrogation_Position=1394; Antisense; GAAGAGGTACAACTGCAAGCGCGAA
>probe:Drosophila_2:1629874_at:511:359; Interrogation_Position=1408; Antisense; GCAAGCGCGAAGTCGAATCGATCTA
>probe:Drosophila_2:1629874_at:337:383; Interrogation_Position=1457; Antisense; GAACGTATCCATGATTTCGAGCTTA
>probe:Drosophila_2:1629874_at:6:113; Interrogation_Position=1488; Antisense; AGCACATGGCCCGAAAATATGCAGC
>probe:Drosophila_2:1629874_at:280:163; Interrogation_Position=1502; Antisense; AAATATGCAGCCCAACGCCACTTAA
>probe:Drosophila_2:1629874_at:315:301; Interrogation_Position=1517; Antisense; CGCCACTTAAGTGCAATAGCTATTG
>probe:Drosophila_2:1629874_at:688:25; Interrogation_Position=1532; Antisense; ATAGCTATTGCCTTAAGTAGAGTGA
>probe:Drosophila_2:1629874_at:13:511; Interrogation_Position=1560; Antisense; GTGAAGATCGCGACCTTTTGCAGGG
>probe:Drosophila_2:1629874_at:480:525; Interrogation_Position=1583; Antisense; GGGCATTATGCCACTATTACACAAG
>probe:Drosophila_2:1629874_at:694:575; Interrogation_Position=1668; Antisense; TGGAAGTTTCCGATTTAAATTCAGA
>probe:Drosophila_2:1629874_at:140:543; Interrogation_Position=1711; Antisense; GGATTATTTGGACGAAATTCGCAAC
>probe:Drosophila_2:1629874_at:48:397; Interrogation_Position=1724; Antisense; GAAATTCGCAACCTTGGACGTCAAG
>probe:Drosophila_2:1629874_at:237:409; Interrogation_Position=1740; Antisense; GACGTCAAGTGAAGTTCCATCAACA

Paste this into a BLAST search page for me
AGGTCGAAATTGTAAGGCATCCTTTGAAGAGGTACAACTGCAAGCGCGAAGCAAGCGCGAAGTCGAATCGATCTAGAACGTATCCATGATTTCGAGCTTAAGCACATGGCCCGAAAATATGCAGCAAATATGCAGCCCAACGCCACTTAACGCCACTTAAGTGCAATAGCTATTGATAGCTATTGCCTTAAGTAGAGTGAGTGAAGATCGCGACCTTTTGCAGGGGGGCATTATGCCACTATTACACAAGTGGAAGTTTCCGATTTAAATTCAGAGGATTATTTGGACGAAATTCGCAACGAAATTCGCAACCTTGGACGTCAAGGACGTCAAGTGAAGTTCCATCAACA

Full Affymetrix probeset data:

Annotations for 1629874_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720