FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629876_at:

>probe:Drosophila_2:1629876_at:46:153; Interrogation_Position=127; Antisense; ACAGGCATGTTATCTTGCCACCGGA
>probe:Drosophila_2:1629876_at:702:595; Interrogation_Position=164; Antisense; TGTGCCGAAGGCTCATCTGATGACC
>probe:Drosophila_2:1629876_at:100:611; Interrogation_Position=184; Antisense; TGACCGAGACGGAGTGGCGCAACCT
>probe:Drosophila_2:1629876_at:653:573; Interrogation_Position=228; Antisense; GGCTGGGTGCACTACATGGTCCACG
>probe:Drosophila_2:1629876_at:600:347; Interrogation_Position=263; Antisense; GCATGTGATTCTATTCCGACGCAAA
>probe:Drosophila_2:1629876_at:225:411; Interrogation_Position=280; Antisense; GACGCAAACGCATTCCGGCAGAGGA
>probe:Drosophila_2:1629876_at:294:657; Interrogation_Position=326; Antisense; TAATGCGGCTCAGGCCATCGCGAAT
>probe:Drosophila_2:1629876_at:307:45; Interrogation_Position=342; Antisense; ATCGCGAATCTCTGCGGTTAGGCGG
>probe:Drosophila_2:1629876_at:613:71; Interrogation_Position=384; Antisense; AGGAATGCTCTTCCAAGGACGCACT
>probe:Drosophila_2:1629876_at:436:355; Interrogation_Position=404; Antisense; GCACTCGTCAATGCTCACGTAGTAT
>probe:Drosophila_2:1629876_at:56:271; Interrogation_Position=431; Antisense; CATAAGTTAGCATCAGGCAGCCTGA
>probe:Drosophila_2:1629876_at:443:477; Interrogation_Position=54; Antisense; GTTTTCTGGCTTTTCGCAATGCCGG
>probe:Drosophila_2:1629876_at:99:379; Interrogation_Position=571; Antisense; GAAGCGTACGCCCTGTGTACAGACA
>probe:Drosophila_2:1629876_at:661:361; Interrogation_Position=69; Antisense; GCAATGCCGGCCGATCAAATTCAAT

Paste this into a BLAST search page for me
ACAGGCATGTTATCTTGCCACCGGATGTGCCGAAGGCTCATCTGATGACCTGACCGAGACGGAGTGGCGCAACCTGGCTGGGTGCACTACATGGTCCACGGCATGTGATTCTATTCCGACGCAAAGACGCAAACGCATTCCGGCAGAGGATAATGCGGCTCAGGCCATCGCGAATATCGCGAATCTCTGCGGTTAGGCGGAGGAATGCTCTTCCAAGGACGCACTGCACTCGTCAATGCTCACGTAGTATCATAAGTTAGCATCAGGCAGCCTGAGTTTTCTGGCTTTTCGCAATGCCGGGAAGCGTACGCCCTGTGTACAGACAGCAATGCCGGCCGATCAAATTCAAT

Full Affymetrix probeset data:

Annotations for 1629876_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720