Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629877_at:

>probe:Drosophila_2:1629877_at:214:387; Interrogation_Position=1841; Antisense; GAACAAGACGTTCGTTTTGCATTTT
>probe:Drosophila_2:1629877_at:316:253; Interrogation_Position=1844; Antisense; CAAGACGTTCGTTTTGCATTTTCTT
>probe:Drosophila_2:1629877_at:471:475; Interrogation_Position=1854; Antisense; GTTTTGCATTTTCTTTAATTTCTCT
>probe:Drosophila_2:1629877_at:85:345; Interrogation_Position=1859; Antisense; GCATTTTCTTTAATTTCTCTTTATT
>probe:Drosophila_2:1629877_at:261:19; Interrogation_Position=1871; Antisense; ATTTCTCTTTATTGTTATCTTATTG
>probe:Drosophila_2:1629877_at:725:475; Interrogation_Position=1884; Antisense; GTTATCTTATTGATTTATGCTTATA
>probe:Drosophila_2:1629877_at:221:445; Interrogation_Position=1910; Antisense; GATGAGATATCGAATCACGTGTGTC
>probe:Drosophila_2:1629877_at:542:635; Interrogation_Position=1919; Antisense; TCGAATCACGTGTGTCAATGTCAAT
>probe:Drosophila_2:1629877_at:450:493; Interrogation_Position=1932; Antisense; GTCAATGTCAATGTCAATGCTTTTA
>probe:Drosophila_2:1629877_at:237:495; Interrogation_Position=1938; Antisense; GTCAATGTCAATGCTTTTATTAATT
>probe:Drosophila_2:1629877_at:215:667; Interrogation_Position=1962; Antisense; TACTCAATAGTGTTTCATTTTCCTC
>probe:Drosophila_2:1629877_at:334:23; Interrogation_Position=1968; Antisense; ATAGTGTTTCATTTTCCTCTTGGGT
>probe:Drosophila_2:1629877_at:250:645; Interrogation_Position=1976; Antisense; TCATTTTCCTCTTGGGTTTTATTCG
>probe:Drosophila_2:1629877_at:321:645; Interrogation_Position=1985; Antisense; TCTTGGGTTTTATTCGCTTTTATTG

Paste this into a BLAST search page for me
GAACAAGACGTTCGTTTTGCATTTTCAAGACGTTCGTTTTGCATTTTCTTGTTTTGCATTTTCTTTAATTTCTCTGCATTTTCTTTAATTTCTCTTTATTATTTCTCTTTATTGTTATCTTATTGGTTATCTTATTGATTTATGCTTATAGATGAGATATCGAATCACGTGTGTCTCGAATCACGTGTGTCAATGTCAATGTCAATGTCAATGTCAATGCTTTTAGTCAATGTCAATGCTTTTATTAATTTACTCAATAGTGTTTCATTTTCCTCATAGTGTTTCATTTTCCTCTTGGGTTCATTTTCCTCTTGGGTTTTATTCGTCTTGGGTTTTATTCGCTTTTATTG

Full Affymetrix probeset data:

Annotations for 1629877_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime