FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629879_at:

>probe:Drosophila_2:1629879_at:339:695; Interrogation_Position=134; Antisense; TTTGCCGACTTGAGCTGCGCAGATC
>probe:Drosophila_2:1629879_at:76:453; Interrogation_Position=155; Antisense; GATCTGCAAGCGTGGGATGCCATTT
>probe:Drosophila_2:1629879_at:701:313; Interrogation_Position=173; Antisense; GCCATTTACCAGGAGCACGAGCAAT
>probe:Drosophila_2:1629879_at:433:233; Interrogation_Position=195; Antisense; AATCCGCTCTGGACACCGAAAGCAT
>probe:Drosophila_2:1629879_at:177:393; Interrogation_Position=212; Antisense; GAAAGCATCGTAGATCGCACTCGCA
>probe:Drosophila_2:1629879_at:64:355; Interrogation_Position=228; Antisense; GCACTCGCAGTCTGATGACCAAGGT
>probe:Drosophila_2:1629879_at:382:167; Interrogation_Position=261; Antisense; AAATGAACCGATGCTTTTTCGCCAG
>probe:Drosophila_2:1629879_at:185:701; Interrogation_Position=275; Antisense; TTTTTCGCCAGCAACGATGTGCCAA
>probe:Drosophila_2:1629879_at:555:249; Interrogation_Position=325; Antisense; CAAGGAACATTTCGCTGCCTACGAG
>probe:Drosophila_2:1629879_at:127:383; Interrogation_Position=361; Antisense; GAACGTGAACACTGCAGCACCCGAT
>probe:Drosophila_2:1629879_at:554:283; Interrogation_Position=401; Antisense; CTGCGCATGCGATTTTTGGACTTCA
>probe:Drosophila_2:1629879_at:239:101; Interrogation_Position=489; Antisense; AGAGCAATGCCAATCGCGAGCGACT
>probe:Drosophila_2:1629879_at:215:417; Interrogation_Position=506; Antisense; GAGCGACTCCAACATGTCCATGACA
>probe:Drosophila_2:1629879_at:632:205; Interrogation_Position=530; Antisense; AAGCGCCTGAAATTGACTGTCCAAA

Paste this into a BLAST search page for me
TTTGCCGACTTGAGCTGCGCAGATCGATCTGCAAGCGTGGGATGCCATTTGCCATTTACCAGGAGCACGAGCAATAATCCGCTCTGGACACCGAAAGCATGAAAGCATCGTAGATCGCACTCGCAGCACTCGCAGTCTGATGACCAAGGTAAATGAACCGATGCTTTTTCGCCAGTTTTTCGCCAGCAACGATGTGCCAACAAGGAACATTTCGCTGCCTACGAGGAACGTGAACACTGCAGCACCCGATCTGCGCATGCGATTTTTGGACTTCAAGAGCAATGCCAATCGCGAGCGACTGAGCGACTCCAACATGTCCATGACAAAGCGCCTGAAATTGACTGTCCAAA

Full Affymetrix probeset data:

Annotations for 1629879_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720