FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629881_at:

>probe:Drosophila_2:1629881_at:70:521; Interrogation_Position=117; Antisense; GTGGACAACCGACGCCAACAAATTG
>probe:Drosophila_2:1629881_at:119:587; Interrogation_Position=140; Antisense; TGGACGCCTCTATTTGGACAATGCT
>probe:Drosophila_2:1629881_at:688:337; Interrogation_Position=162; Antisense; GCTACGCTTAGCTGGAATGGAAACG
>probe:Drosophila_2:1629881_at:503:41; Interrogation_Position=192; Antisense; ATCGGCCGCCAGATGATCGAGAGCT
>probe:Drosophila_2:1629881_at:460:423; Interrogation_Position=210; Antisense; GAGAGCTACTTTCAGGAGCTGCCAT
>probe:Drosophila_2:1629881_at:201:555; Interrogation_Position=260; Antisense; GGACGCGCAGCCTATTGTGGATCAG
>probe:Drosophila_2:1629881_at:465:593; Interrogation_Position=275; Antisense; TGTGGATCAGGCTGTGTCCAACCAG
>probe:Drosophila_2:1629881_at:426:263; Interrogation_Position=320; Antisense; CAGCGGCTCCGTCAAGTTCGCAGAT
>probe:Drosophila_2:1629881_at:373:471; Interrogation_Position=335; Antisense; GTTCGCAGATCAGCAGTTACGCAAA
>probe:Drosophila_2:1629881_at:642:473; Interrogation_Position=350; Antisense; GTTACGCAAATTTCAGCAGACTTTC
>probe:Drosophila_2:1629881_at:84:105; Interrogation_Position=367; Antisense; AGACTTTCATCGTTACCGCCGAGAA
>probe:Drosophila_2:1629881_at:304:227; Interrogation_Position=397; Antisense; AATGGAAGGTCGTCTCCGATTGCTA
>probe:Drosophila_2:1629881_at:666:497; Interrogation_Position=408; Antisense; GTCTCCGATTGCTACCGAATGCAGG
>probe:Drosophila_2:1629881_at:132:79; Interrogation_Position=433; Antisense; AGGTCTGAGATCCACACACTTGTAT

Paste this into a BLAST search page for me
GTGGACAACCGACGCCAACAAATTGTGGACGCCTCTATTTGGACAATGCTGCTACGCTTAGCTGGAATGGAAACGATCGGCCGCCAGATGATCGAGAGCTGAGAGCTACTTTCAGGAGCTGCCATGGACGCGCAGCCTATTGTGGATCAGTGTGGATCAGGCTGTGTCCAACCAGCAGCGGCTCCGTCAAGTTCGCAGATGTTCGCAGATCAGCAGTTACGCAAAGTTACGCAAATTTCAGCAGACTTTCAGACTTTCATCGTTACCGCCGAGAAAATGGAAGGTCGTCTCCGATTGCTAGTCTCCGATTGCTACCGAATGCAGGAGGTCTGAGATCCACACACTTGTAT

Full Affymetrix probeset data:

Annotations for 1629881_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720