FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629882_at:

>probe:Drosophila_2:1629882_at:701:157; Interrogation_Position=378; Antisense; ACACTGAAATCCAGCGACGAGGTCA
>probe:Drosophila_2:1629882_at:87:139; Interrogation_Position=403; Antisense; ACGATGATGAGGATCCGCTCCAGGA
>probe:Drosophila_2:1629882_at:237:55; Interrogation_Position=490; Antisense; ATGCAACGCCAGTGGCTCAAGCAGA
>probe:Drosophila_2:1629882_at:539:25; Interrogation_Position=522; Antisense; ATAGAAGCCCTGCTTGAAGGACTGG
>probe:Drosophila_2:1629882_at:284:557; Interrogation_Position=540; Antisense; GGACTGGGCGAAGCAAACCGAATTA
>probe:Drosophila_2:1629882_at:199:573; Interrogation_Position=566; Antisense; GGCGGAGAAACGCATTCTGGCCTAC
>probe:Drosophila_2:1629882_at:423:9; Interrogation_Position=579; Antisense; ATTCTGGCCTACCTATGCAAATGCA
>probe:Drosophila_2:1629882_at:350:683; Interrogation_Position=592; Antisense; TATGCAAATGCAATCTGCGCGCCCT
>probe:Drosophila_2:1629882_at:724:623; Interrogation_Position=607; Antisense; TGCGCGCCCTGAACGACGAGCAAAT
>probe:Drosophila_2:1629882_at:275:667; Interrogation_Position=707; Antisense; TACATACATGCCGTGATAGGATATC
>probe:Drosophila_2:1629882_at:410:21; Interrogation_Position=797; Antisense; ATATCTGGACAATTATCTTAAGCGA
>probe:Drosophila_2:1629882_at:171:701; Interrogation_Position=837; Antisense; TTTTTCCAAATGTATGCTTCCCTAA
>probe:Drosophila_2:1629882_at:141:709; Interrogation_Position=884; Antisense; TTAACCTAATCTTCGCATCTAATGA
>probe:Drosophila_2:1629882_at:697:455; Interrogation_Position=947; Antisense; GATAAAACATTAACACGCCTGTGAT

Paste this into a BLAST search page for me
ACACTGAAATCCAGCGACGAGGTCAACGATGATGAGGATCCGCTCCAGGAATGCAACGCCAGTGGCTCAAGCAGAATAGAAGCCCTGCTTGAAGGACTGGGGACTGGGCGAAGCAAACCGAATTAGGCGGAGAAACGCATTCTGGCCTACATTCTGGCCTACCTATGCAAATGCATATGCAAATGCAATCTGCGCGCCCTTGCGCGCCCTGAACGACGAGCAAATTACATACATGCCGTGATAGGATATCATATCTGGACAATTATCTTAAGCGATTTTTCCAAATGTATGCTTCCCTAATTAACCTAATCTTCGCATCTAATGAGATAAAACATTAACACGCCTGTGAT

Full Affymetrix probeset data:

Annotations for 1629882_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720