FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629884_at:

>probe:Drosophila_2:1629884_at:568:173; Interrogation_Position=6062; Antisense; AAAGCAGGTCCACCAAGCGAGGGAA
>probe:Drosophila_2:1629884_at:148:433; Interrogation_Position=6080; Antisense; GAGGGAAGTGCTCCCGCTTACGACT
>probe:Drosophila_2:1629884_at:382:337; Interrogation_Position=6137; Antisense; GCTCCTCCGCCAACGTATGAAGAAA
>probe:Drosophila_2:1629884_at:684:589; Interrogation_Position=6187; Antisense; TGGTGCCTATGGCTATCCACAAGGA
>probe:Drosophila_2:1629884_at:629:299; Interrogation_Position=6222; Antisense; CGCCCAGCCAGAATCAGTATTACGG
>probe:Drosophila_2:1629884_at:537:481; Interrogation_Position=6238; Antisense; GTATTACGGCATGATCAGCCACCAG
>probe:Drosophila_2:1629884_at:695:121; Interrogation_Position=6281; Antisense; AGCGGGCAGCCCAACTACGGTATGA
>probe:Drosophila_2:1629884_at:469:397; Interrogation_Position=6304; Antisense; GACACATGGCAGTGGCTTCGGACTT
>probe:Drosophila_2:1629884_at:450:621; Interrogation_Position=6328; Antisense; TGCTGGTCCCAGTACGTCGGCAGGA
>probe:Drosophila_2:1629884_at:726:495; Interrogation_Position=6483; Antisense; GTCAGCCTGTGGTTCTCAAGCAAAA
>probe:Drosophila_2:1629884_at:529:67; Interrogation_Position=6534; Antisense; ATGGCACACCATTTACTCGAATATA
>probe:Drosophila_2:1629884_at:86:33; Interrogation_Position=6556; Antisense; ATAATCATGTTGTACCTCTTTCCAC
>probe:Drosophila_2:1629884_at:21:281; Interrogation_Position=6571; Antisense; CTCTTTCCACTCCTTTGATGTTATA
>probe:Drosophila_2:1629884_at:674:637; Interrogation_Position=6618; Antisense; TCGTTTCGTCCTCGCGTATATTTGA

Paste this into a BLAST search page for me
AAAGCAGGTCCACCAAGCGAGGGAAGAGGGAAGTGCTCCCGCTTACGACTGCTCCTCCGCCAACGTATGAAGAAATGGTGCCTATGGCTATCCACAAGGACGCCCAGCCAGAATCAGTATTACGGGTATTACGGCATGATCAGCCACCAGAGCGGGCAGCCCAACTACGGTATGAGACACATGGCAGTGGCTTCGGACTTTGCTGGTCCCAGTACGTCGGCAGGAGTCAGCCTGTGGTTCTCAAGCAAAAATGGCACACCATTTACTCGAATATAATAATCATGTTGTACCTCTTTCCACCTCTTTCCACTCCTTTGATGTTATATCGTTTCGTCCTCGCGTATATTTGA

Full Affymetrix probeset data:

Annotations for 1629884_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720