FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629885_at:

>probe:Drosophila_2:1629885_at:654:327; Interrogation_Position=141; Antisense; GCGTGCAATGCAACAAGACTCTAGA
>probe:Drosophila_2:1629885_at:416:643; Interrogation_Position=160; Antisense; TCTAGACTCAACTCTTCACTGTGAT
>probe:Drosophila_2:1629885_at:127:643; Interrogation_Position=172; Antisense; TCTTCACTGTGATGGTCCGGACAAG
>probe:Drosophila_2:1629885_at:344:533; Interrogation_Position=242; Antisense; GGTTACGGGCACATCGGCATTTCGT
>probe:Drosophila_2:1629885_at:160:521; Interrogation_Position=301; Antisense; GTGGCAAAGCGACATGGCTCCCAAA
>probe:Drosophila_2:1629885_at:139:235; Interrogation_Position=361; Antisense; AATCGGAGAAGGATGCCCACGTTGT
>probe:Drosophila_2:1629885_at:593:481; Interrogation_Position=395; Antisense; GTATTCGCCGCGGAACAAGTTCTCT
>probe:Drosophila_2:1629885_at:602:287; Interrogation_Position=440; Antisense; CGGAAGTGCTTCAAGTGTCGGGACT
>probe:Drosophila_2:1629885_at:146:599; Interrogation_Position=455; Antisense; TGTCGGGACTGCACCAAAACTCTGG
>probe:Drosophila_2:1629885_at:453:641; Interrogation_Position=475; Antisense; TCTGGACTCCATTATCGCGTGCGAT
>probe:Drosophila_2:1629885_at:402:439; Interrogation_Position=497; Antisense; GATGGTCCGGACAATGAGGTCTACT
>probe:Drosophila_2:1629885_at:200:69; Interrogation_Position=555; Antisense; ATGGCTACGGATTCGCCTGTGGATC
>probe:Drosophila_2:1629885_at:393:519; Interrogation_Position=573; Antisense; GTGGATCCAGTTTCCTGCAAACCGA
>probe:Drosophila_2:1629885_at:183:23; Interrogation_Position=74; Antisense; ATATATGTGTATGCCGCCGAGCAGA

Paste this into a BLAST search page for me
GCGTGCAATGCAACAAGACTCTAGATCTAGACTCAACTCTTCACTGTGATTCTTCACTGTGATGGTCCGGACAAGGGTTACGGGCACATCGGCATTTCGTGTGGCAAAGCGACATGGCTCCCAAAAATCGGAGAAGGATGCCCACGTTGTGTATTCGCCGCGGAACAAGTTCTCTCGGAAGTGCTTCAAGTGTCGGGACTTGTCGGGACTGCACCAAAACTCTGGTCTGGACTCCATTATCGCGTGCGATGATGGTCCGGACAATGAGGTCTACTATGGCTACGGATTCGCCTGTGGATCGTGGATCCAGTTTCCTGCAAACCGAATATATGTGTATGCCGCCGAGCAGA

Full Affymetrix probeset data:

Annotations for 1629885_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720